Labshake search
Citations for Agilent :
2751 - 2800 of 3515 citations for Propane 1 2 Diyl Diacetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Blots were incubated with anti-IαI rabbit polyclonal Dako antibody (1:8000; Agilent Technologies, Santa Clara, CA), followed by IRDye® 800CW donkey anti-rabbit secondary (1:15,000 ...
-
bioRxiv - Biochemistry 2021Quote: Primary antibodies used in this study were rabbit polyclonal anti-ubiquitin antibody (Dako, discontinued, 1:2000 dilution), monoclonal mouse anti-Flag M2 (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... The hybridized slides were washed using Gene Expression Wash Buffer 1 (Agilent Technologies, Part Number 5188-5325) and Gene Expression Wash Buffer 2 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Biophysics 2020Quote: ... The cHMM cDNA was cloned into the pShuttle-IRES-hrGFP-1 vector (Agilent Tech., Santa Clara, CA) and an AdcHMM-Flag virus was prepared and amplified for expression of cHMM protein in C2C12 cells [36] ...
-
bioRxiv - Immunology 2021Quote: ... sections were immunolabelled using a rabbit anti-MPO polyclonal affinity purified antibody (1:500; Dako Omnis, A0398) and incubated with Dako anti-rabbit HRP polymer (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... washed with TBS-T and next incubated with HRP-conjugated anti-mouse IgG (1:2000, DAKO, P0447) or anti-rabbit IgG (1:2000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry was performed after the hybridization using rabbit polyclonal antibodies against GFAP (1:250; GA524; Agilent Dako) overnight at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry was performed after the hybridization using rabbit polyclonal antibodies against GFAP (1:250; GA524; Agilent Dako) overnight at RT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and their integrity was assessed via 1% agarose gel electrophoresis or Bioanalyzer RNA 6000 Nano kit (Agilent). Library quantification ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... USA) and fragmentation analyzed by 1% agarose gel electrophoresis and High Sensitivity Bioanalyzer 2100 assay (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... sections were washed in PBS and incubated with a goat anti-mouse HRP IgG (1:100, Dako) secondary antibody for 30 min at RT ...
-
bioRxiv - Genetics 2023Quote: ... We pooled 1 μL of each library and fragment size was assessed with Bioanalyzer 2100 (Agilent™) using the High sensitivity DNA kit (#5067-4626) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C with anti-total tau primary antibody solution (1: 5000, DAKO A0024). After 1 hour incubation at RT in the corresponding secondary antibody solution (donkey anti-rabbit 800) ...
-
bioRxiv - Immunology 2023Quote: ... proteins were extracted from the cytosol fraction by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were extracted from sucrose gradient fractions by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 uL In-Fusion reaction mix was transformed into commercial chemically competent Escherichia coli (XL10-Gold, Agilent). Colonies were manually picked into Lysogeny broth supplemented with 100 μg/mL ampicillin in a 96-well block the next day after transformation and incubated in a shaker (MaxQ 5000 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL gas sample of head space was withdrawn and injected into the gas chromatography (Agilent 7890B) utilizing a gas-tight syringe to measure ethylene concentration ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg RNA was used to synthesise cDNA using the Multi-temp cDNA Synthesis kit (Agilent, #200436). The final reaction volume was made up to 1ml with nuclease free water and used for RT-qPCR analysis.
-
bioRxiv - Genomics 2024Quote: ... DNA length was assessed by running 1 μl on a genomic screentape on the TapeStation 4200 (Agilent). DNA concentration was assessed using the dsDNA BR assay on a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... Blocking was performed for 1 hour in PBS supplemented with 10% normal goat serum (NGS) (Agilent, X0907). The cells were incubated overnight at 4°C with primary antibodies (Supplementary table 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were further incubated with a goat anti-rabbit HRP-conjugated secondary antibody (1:2000, DAKO) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: 1 x 105 BMDMs were seeded in Agilent Seahorse XF24 Cell Culture Microplate (Agilent Technologies, 100777-004) and treated as required by experiments ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Cancer Biology 2023Quote: ... or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp) on a Fragment Analyzer (Agilent). Libraries were quantified by Qubit dsDNA HS Assay (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: Full-length human Plk3 (1-646 aa; accession number NM_004073) cloned into a pCMV-Tag2A vector (Stratagene) to construct a Flag-tagged expression plasmid was described previously (Li et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... TAP-tagged proteins were detected using rabbit antiperoxidase antibody linked to peroxidase (PAP, Dako; 1:10000 dilution). Tubulin was detected using mouse-anti-α-tubulin antibody (Sigma-Aldrich T5168 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed in TBST and probed with secondary antibodies: anti-rabbit HRP (Dako, P0448, 1:2000) for E-Cadherin and Vimentin ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Immunology 2024Quote: ... the plates were incubated with polyclonal Rabbit Anti-Mouse HRP (1/3000 dilution, Cat. No. P0260, DAKO) for 2 hours at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Pathology 2024Quote: ... 1:300 in PBS and then for 30 min to horseradish peroxidase-conjugated streptavidin (P0397, Agilent Dako) 1:1000 in PBS ...
-
bioRxiv - Pathology 2024Quote: ... 1:300 in PBS and then for 30 min to horseradish peroxidase-conjugated streptavidin (P0397, Agilent Dako) 1:1000 in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently incubated with primary antibody solution containing rabbit anti-GFAP [1:500] (DAKO, Z0334) in blocking solution for 24 hr at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected and filtered with Captiva EMR cartridges (40 mg, 1 mL; Agilent Technologies, Australia) to remove the lipid fraction using a positive pressure manifold (Agilent PPM48 Processor ...
-
bioRxiv - Neuroscience 2024Quote: ... The secondary antibody was added at a 1:2000 final concentration: Goat anti-mouse HRP (P0447; Dako) and goat anti-rabbit HRP (P0448 ...
-
bioRxiv - Genomics 2024Quote: ... To quality control and quantify libraries 1 ul of cleaned mtATAC library was run on Bioanalyzer (Agilent). mtATAC libraries were sequenced on MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Unstained 4-m thick sections were labeled with H&E or anti-CD79a (1:2000, Dako M7050) and anti-CD56 (1:200 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 ml of the purified upper layer was transferred to an amber glass vial (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: 1×104 OE19 cells were reverse transfected with siRNAs and seeded into 96-well plates (Agilent, 102601-100). 24 hours post-transfection cells were treated with 500 nM lapatinib or vehicle control ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies used for immunoblotting were Horseradish Peroxidase (HRP)-conjugated swine anti-rabbit (DAKO, cat# P0399; 1:4,000) or goat anti-mouse (DAKO ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibody was detected after probing for 1 hour with HRP-linked rabbit anti-mouse IgG (P0161, Dako) or goat anti-rabbit IgG (P0448 ...
-
bioRxiv - Pathology 2020Quote: ... used at a dilution of 1:50 and a FITC-conjugated rabbit polyclonal antibody to IgA (Dako, F0204). The polyclonal sheep anti-nephrin antibody was also directly conjugated to Alexa-488 using NHS chemistry ...
-
bioRxiv - Immunology 2021Quote: ... MSP-142 and AMA-1 were biotinylated and tetramerized with streptavidin-PE (SA-PE; Agilent, Santa Clara, CA) as previously described.46 A decoy reagent to gate out the non-MSP-142 or AMA-1–specific B cells was constructed by conjugating SA-PE to DyLight 650 (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-SOX17, and anti-SOX9 (MerckMillipore, AB5535, 1:300) antibodies and visualization with EnVision FLEX Mini kit (DAKO).