Labshake search
Citations for Agilent :
2751 - 2800 of 4126 citations for 7 Quinolinamine 1 2 3 4 tetrahydro 1 methyl hydrochloride 1 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and fixed with precooled methyl alcohol in −20℃ for 30 min followed by H&E staining (Eosin, Dako CS701, Hematoxylin Dako S3309, bluing buffer CS702), sections were processed at RT by isopropanol (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Microbiology 2022Quote: ... LMP1 (CS1-4; Dako), CD81 (B399 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries hybridisation was performed as described previously 68 using probes mapping to 122 polycomb target genes promoters and 78 control active gene promoters ...
-
bioRxiv - Pathology 2024Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-LMP1 (CS1-4, Dako), anti-LMP2A (MCA2467 ...
-
bioRxiv - Molecular Biology 2021Quote: ... MRI of lung was performed with a 7-T Agilent scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console and an actively shielded gradient set (205/120 insert of maximum 130 mT m-1 gradient strength) ...
-
bioRxiv - Cancer Biology 2020Quote: TP53 IHC was performed using monoclonal anti-TP53 antibody clone DO-7 (Dako, Carpinteria, CA, USA) using standard techniques described elsewhere57 on whole BM biopsy sections in a CLIA-certified laboratory ...
-
bioRxiv - Bioengineering 2022Quote: Dynamic release was performed using the 400-DS Apparatus 7 instrument (Agilent Technologies, Santa Clara, CA) at 37 °C in a 10 mL cell ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA with RNA Integrity Number (RIN) > 7 when assessed using the Agilent 2100 Bioanalyzer (Agilent, USA) were selected to move forward for further sequencing.
-
bioRxiv - Physiology 2024Quote: MRI studies were performed using a 7-T Agilent/Varian scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescent images were obtained on a Keyence BZ-X710 microscope or on a Cytation 7 (Agilent).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We quantified sample RNA quantity and quality (RNA integrity number > 7) on a Tapestation 2200 (Agilent) at the University of Montana genomics core ...
-
bioRxiv - Cancer Biology 2024Quote: ... whereas RNA integrity (RIN>7) was confirmed using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA).
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Cancer Biology 2019Quote: MRI conducted at UT Southwestern was performed using a 7-Tesla small animal MRI system (Agilent Inc.) with a 40 mm (i.d. ...
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation as with the mitochondrial stress test astrocytes were transferred to XFmedia (Agilent) and glycolysis was assessed ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 μg of pAAV-RC (Stratagene), and 4 μg of pHelper (Stratagene) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 4 μg of pHelper (Stratagene). The other was 1 mL of Opti-MEM plus 45 μL of Lipofectamine® 2000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×44K (G4112F, Agilent Technologies, Germany).
-
bioRxiv - Neuroscience 2023Quote: ... and 4% normal goat serum (Dako) in PBS for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...