Labshake search
Citations for Agilent :
2751 - 2800 of 3445 citations for 6 Bromo 3 4 dihydro 2H 1 benzothiin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 1 μg RNA was used to synthesise cDNA using the Multi-temp cDNA Synthesis kit (Agilent, #200436). The final reaction volume was made up to 1ml with nuclease free water and used for RT-qPCR analysis.
-
bioRxiv - Genomics 2024Quote: ... DNA length was assessed by running 1 μl on a genomic screentape on the TapeStation 4200 (Agilent). DNA concentration was assessed using the dsDNA BR assay on a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... Blocking was performed for 1 hour in PBS supplemented with 10% normal goat serum (NGS) (Agilent, X0907). The cells were incubated overnight at 4°C with primary antibodies (Supplementary table 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were further incubated with a goat anti-rabbit HRP-conjugated secondary antibody (1:2000, DAKO) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: 1 x 105 BMDMs were seeded in Agilent Seahorse XF24 Cell Culture Microplate (Agilent Technologies, 100777-004) and treated as required by experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... USA) and fragmentation analyzed by 1% agarose gel electrophoresis and High Sensitivity Bioanalyzer 2100 assay (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... sections were washed in PBS and incubated with a goat anti-mouse HRP IgG (1:100, Dako) secondary antibody for 30 min at RT ...
-
bioRxiv - Genetics 2023Quote: ... We pooled 1 μL of each library and fragment size was assessed with Bioanalyzer 2100 (Agilent™) using the High sensitivity DNA kit (#5067-4626) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...
-
bioRxiv - Immunology 2023Quote: ... proteins were extracted from the cytosol fraction by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were extracted from sucrose gradient fractions by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed in TBST and probed with secondary antibodies: anti-rabbit HRP (Dako, P0448, 1:2000) for E-Cadherin and Vimentin ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Cancer Biology 2023Quote: ... or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp) on a Fragment Analyzer (Agilent). Libraries were quantified by Qubit dsDNA HS Assay (Life Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... Conjugated anti-rabbit and anti-mouse immunoglobulins were used as the secondary antibodies (Agilent Dako, 1:20000). Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare) ...
-
bioRxiv - Plant Biology 2024Quote: ... Conjugated anti-rabbit and anti-mouse immunoglobulins were used as the secondary antibodies (Agilent Dako, 1:20000). Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Cancer Biology 2021Quote: 1×104 OE19 cells were reverse transfected with siRNAs and seeded into 96-well plates (Agilent, 102601-100). 24 hours post-transfection cells were treated with 500 nM lapatinib or vehicle control ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies used for immunoblotting were Horseradish Peroxidase (HRP)-conjugated swine anti-rabbit (DAKO, cat# P0399; 1:4,000) or goat anti-mouse (DAKO ...
-
bioRxiv - Microbiology 2019Quote: ... Japan) equipped with a 30 m × 0.25 mm DB-1 capillary gas chromatography column (Agilent Technologies, CA, USA). For analysis ...
-
bioRxiv - Developmental Biology 2019Quote: ... All samples were sequentially washed and incubated with a mouse monoclonal anti-human CD31 (Dako, M0823, 1:100) and Alexa488-conjugated goat anti-mouse secondary antibody (ThermoFisher ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibody was detected after probing for 1 hour with HRP-linked rabbit anti-mouse IgG (P0161, Dako) or goat anti-rabbit IgG (P0448 ...
-
bioRxiv - Neuroscience 2019Quote: Antibody specificity was tested using a negative staining procedure with normal rabbit IgG (1:250; Dako, Glostrup, Denmark) instead of the primary antibodies ...
-
bioRxiv - Immunology 2019Quote: ... AGP-1 containing fractions were pooled and concentrated by spin concentrators (10 kDa cut off) (Agilent Technologies, USA). The concentrate was then applied to a DEAE-cellulose column (25 x 0.5 cm ...
-
bioRxiv - Pathology 2020Quote: ... used at a dilution of 1:50 and a FITC-conjugated rabbit polyclonal antibody to IgA (Dako, F0204). The polyclonal sheep anti-nephrin antibody was also directly conjugated to Alexa-488 using NHS chemistry ...
-
bioRxiv - Immunology 2021Quote: ... MSP-142 and AMA-1 were biotinylated and tetramerized with streptavidin-PE (SA-PE; Agilent, Santa Clara, CA) as previously described.46 A decoy reagent to gate out the non-MSP-142 or AMA-1–specific B cells was constructed by conjugating SA-PE to DyLight 650 (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-SOX17, and anti-SOX9 (MerckMillipore, AB5535, 1:300) antibodies and visualization with EnVision FLEX Mini kit (DAKO).
-
bioRxiv - Neuroscience 2021Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ∼20 nl/minute ...
-
bioRxiv - Pathology 2021Quote: ... the sections were immunostained with antibodies against the following: glial fibrillary acidic protein (GFAP, polyclonal, 1:1,500, Dako); α-smooth muscle actin (SMA ...
-
bioRxiv - Plant Biology 2020Quote: ... The fragments were diluted to reach a concentration range of 1-10 ng/μL as required by Agilent High Sensitivity DNA kit ...
-
bioRxiv - Microbiology 2020Quote: ... Polyclonal goat anti-mouse IgG/HRP and Polyclonal goat anti-rabbit IgG/HRP (1:2000) were from Dako, Denmark ...
-
bioRxiv - Cell Biology 2021Quote: ... An inducible V-1 expression plasmid was created by first PCR- amplifying the mtpn gene with V-1 F and V-1 R oligos (dictyBase:DDB_G0268038) using Ax2 genomic DNA then TA cloning the product using StrataClone (Agilent) to generateV-1 SC ...
-
bioRxiv - Microbiology 2021Quote: ... plates were probed with 100 μl/well of goat anti-mouse IgG HRP (1:2000; Agilent Dako, Denmark) diluted in PBS/BSA for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... plates were probed with 100 μl/well of goat anti-mouse IgG HRP (1:2000; Agilent Dako, Denmark) diluted in PBS/BSA for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-Spike antibody binding was detected using HRP-conjugated anti-rabbit secondary antibodies (1 in 7000 dilution) (Dako) and visualized using ECL (KPL ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h at room temperature and positive signals were visualized with the diaminobenzidine (DAB) substrate (Dako, #K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibody was detected after probing for 1 hour with HRP-linked rabbit anti-mouse IgG (P0161, Dako) or goat anti-rabbit IgG (P0448 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slices were incubated with primary antibodies: rabbit polyclonal anti-PSMA/GCPII (1:150) (M362029-2; DAKO, US), anti-CD68 (1:250 ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody (MX-A: Millipore Sigma, MABF938; IBA-1: Wako, 019-19741; CD3: Dako, A0452; MPO: Dako, A0398) was added to slides at a dilution (MX-A ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody (MX-A: Millipore Sigma, MABF938; IBA-1: Wako, 019-19741; CD3: Dako, A0452; MPO: Dako, A0398) was added to slides at a dilution (MX-A ...
-
bioRxiv - Microbiology 2022Quote: ... coli XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)]) (Stratagene) was used for general cloning and E ...
-
bioRxiv - Microbiology 2022Quote: ... sections were incubated with peroxidase labeled goat-anti-Rabbit IgG (1:100) (P0448, DAKO, Agilent Technologies Netherlands B.V) in PBS/0,1% BSA for 1h at RT ...
-
bioRxiv - Microbiology 2022Quote: ... sections were incubated with peroxidase labeled goat-anti-Rabbit IgG (1:100) (P0448, DAKO, Agilent Technologies Netherlands B.V) in PBS/0,1% BSA for 1h at RT ...