Labshake search
Citations for Agilent :
2701 - 2750 of 8383 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies, 240207) and sequenced with M13 Forward ...
-
bioRxiv - Neuroscience 2023Quote: ... and their quality was assessed using the Bioanalyzer High-Sensitivity DNA kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Integrity of RNA samples was evaluated using the RNA 6000 Nano Kit (Agilent) and the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Immunology 2023Quote: ... and was analyzed for quality using the RNA 6000 Pico Kit (Agilent Technologies). Poly(A)-enriched next-generation sequencing library construction was performed using the KAPA mRNA Hyper Prep Kit (KAPA Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... The divIVAR94N allele was generated using the QuikChange site-directed mutagenesis kit (Agilent). For B ...
-
bioRxiv - Immunology 2023Quote: ... and quality was checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Libraries were sequenced with the NovaSeq 6000 platform (S1 Cartridge ...
-
bioRxiv - Immunology 2023Quote: ... Library quality was assessed using a 2100 Bioanalyzer High Sensitivity DNA kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: The TeloFISH was carried out using the Telomere PNA FISH Kit/Cy3 (Dako), following the manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP S61A mutant was generated utilizing a QuikChange site-directed mutagenesis kit (Agilent) and confirmed by sequencing (Eurofins Genomics).
-
bioRxiv - Cell Biology 2023Quote: ... Appropriate mutagenesis was done using QuikChange Lightning Multi Site-Directed mutagenesis kit (Agilent). Final product plasmids were confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2023Quote: ... Glycolytic parameters were measured using the glycolysis stress test kit (Agilent; 103020-100), measurement of ECAR (extracellular acidification rate ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... Point mutations were generated using the QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... C328H and C328D were generated by site directed mutagenesis using kits from Agilent or Nzytech ...
-
bioRxiv - Cancer Biology 2022Quote: ... and final sequencing libraries were performed using Bioanalyzer High Sensitivity DNA Kit (Agilent). The sequencing libraries for scRNAseq and scTCRseq were normalized to 4nM concentration and pooled using a volume ratio of 4:1 ...
-
bioRxiv - Genomics 2023Quote: ... and assessed for fragment size using the BioAnalyzer HS DNA Assay kit (Agilent). Following library pooling in equimolar concentrations ...
-
bioRxiv - Genomics 2023Quote: ... Individual library Qc was performed using the BioAnalyzer HS DNA Assay kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Mitochondrial respiration was measured using Seahorse XF Cell Mito Stress Test kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Using the DNA high-sensitivity kit in the 2100 Bioanalyzer (Agilent Technologies, USA), the library quality and quantity of the appropriate fragment length (250 bp ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from NSC34 cells using the Absolutely RNA Microprep kit (Agilent). The rRNA levels were measured by real-time quantitative PCR after reverse transcription of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and verified using the Bioanalyzer DNA High Sensitivity Assay Kit (Agilent, 5067-4626). Validated samples were sequenced using the NextSeq1000/2000 P2 Reagents (100 Cycles ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was measured using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together and performed paired-end sequencing on an Illumina Hi-Seq 2000.
-
bioRxiv - Neuroscience 2023Quote: ... Mutagenesis was performed using the QuikChange II Site-directed Mutagenesis kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA integrity was analyzed using NanoChip (Agilent RNA 6000 Nano kit, 5067-1511). A total of 2 µg RNA was purified by poly(A ...
-
bioRxiv - Physiology 2023Quote: ... A high sensitivity small DNA Fragment Analysis kit (Agilent Technologies, DNF-477-0500) was used to assess the quality of each library pool.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were constructed using the Sure Select All Exon v6 library kit (Agilent) following the XT library preparation workflow ...
-
bioRxiv - Plant Biology 2023Quote: ... and size distribution was determined using the Agilent High Sensitivity DNA Kit (Agilent). Libraries were pooled together for paired-end sequencing on an Illumina Hi-Seq 3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified libraries were run on Agilent High Sensitivity DNA Kit chip (Agilent Technologies) to verify the expected size distribution ...
-
bioRxiv - Neuroscience 2023Quote: ... Library quality was assessed by high sensitivity DNA analysis kit (Agilent, 5067-4626) on the 2100 Bioanalyzer instrument ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA integrity was validated using the Agilent 6000 Pico Kit (Agilent, #5067-1513). For each sample ...
-
bioRxiv - Genetics 2023Quote: Genotyping was performed using the Herculase II Fusion DNA Polymerases kit (Agilent, #600677) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed by QuikChange Site-directed Mutagenesis Kit (Agilent 200523). Multi site-directed mutagenesis was performed by QuikChange Multi site-directed Mutagenesis Kit (Agilent 200513) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis was performed using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... and integrity using Bioanalyzer 2100 and RNA Nano 6000 Kit (Agilent Technologies, USA). Sequencing libraries were generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... Retrovirus production was performed according to the MBS Mammalian Transfection Kit (Agilent Technologies) and virus was harvested after 2 days from confluent cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Whole exome sequencing (WES) was performed using the Mouse All Exon kit (Agilent) for target capture followed by next-generation sequencing by Psomagen ...
-
bioRxiv - Molecular Biology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Cat. No. 103015-100, Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A Plant RNA Pico kit was used on a 2100 Bioanalyzer (Agilent Technologies) to confirm the quality of the RNA isolates ...
-
bioRxiv - Genomics 2024Quote: ... and Fragment Analyser using the DNA HS 50kb large fragment kit (Agilent Tech.) Before PacBio HiFi library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HS-D5000 and HS-D1000 High Sensitivity DNA kits (Agilent Technologies), respectively ...
-
bioRxiv - Biophysics 2024Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Plant Biology 2024Quote: ... or Femto Pulse Genomic DNA 165 kb Kit (Agilent cat# FP-1002-0275). For samples sourced from “OCBD” (Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and integrity (Agilent RNA 6000 Pico kit; Agilent Technologies, Santa Clara, CA, USA). The average RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2024Quote: Protein variants were constructed using a QuikChange site-directed mutagenesis kit (Agilent, USA). The primer that introduced desired nucleotide changes was designed using QuikChange online tool (Table S3C ...
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...