Labshake search
Citations for Agilent :
2701 - 2750 of 4735 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were mounted using Fluorescent Mounting Medium (DAKO, S302380-2). To label proliferating myoblasts ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies were HRP-coupled: anti-mouse (P026002-2, Dako), anti-rabbit (A16029 ...
-
bioRxiv - Genetics 2021Quote: ... Mounting was performed using Fluorescence Mounting Medium (Agilent, S302380-2). Confocal Images were taken with a Zeiss LSM 700 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Quikchange 2 Site-Directed Mutagenesis Kit (Agilent Technologies 210518) was used to introduce the two mutations ...
-
bioRxiv - Pathology 2019Quote: ... in high pH antigen retrieval solution (Agilent DAKO, K800421-2) and incubated at 90°C for 20 minutes ...
-
bioRxiv - Pathology 2019Quote: ... in high pH antigen retrieval solution (Agilent DAKO, K800421-2) and incubated at 90°C for 20 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were mounted using DAKO mounting medium (Agilent, S302380-2).
-
bioRxiv - Biochemistry 2021Quote: ... 2) biotinylated goat anti-mouse Ig antibody (Dako, Glostrup, Denmark), diluted 1:5000 with TBS-BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM glutamine (XF Glutamine solution, 103579-100, Agilent) and cells were incubated in the absence of CO2 for 45 min before measurement ...
-
bioRxiv - Genetics 2021Quote: ... ii) Agilent SureSelect Clinical Research Exome version 2 (Agilent Technologies) or iii ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by blocking with Dako Protein Block (Agilent X090930-2). Cutaneous melanocytes were labeled with anti-gp100 primary antibody (1:100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Immunohistochemistry (IHC) for human CD45 antibodies (IR75161-2, Agilent Technologies) was performed on FFPE blocks of engrafted tumors to identify cases of lymphomagenesis ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 uL of anti-GFAP antibody (Agilent, Z033429-2) diluted in 200 uL of the blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... samples were incubated for 2 h with Protein Block (Dako). Samples were incubated overnight at 4°C with mouse and rabbit monoclonal antibodies against PCNA (Cell Signaling ...
-
bioRxiv - Pathology 2020Quote: ... we used a combination of WT1 (Agilent Technologies; IS05530-2) and DACH1 (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2020Quote: Reactions were performed in 2 mL glass HPLC vials (Agilent) charged with nucleophile (final conc ...
-
bioRxiv - Microbiology 2021Quote: ... and CD68 (clone KP1) mouse monoclonal (Agilent cat#M081401-2). Secondary antibodies include Discovery Red 610 (Roche Tissue Diagnostics cat#760-245) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 ng psiCHECK reporters and 2 μg pBlueScript II (Stratagene) were transfected using TransIT-293 Transfection Reagent (Mirus) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM sodium pyruvate and 25 mM glucose (all Agilent) for 1 h in a non-CO2 incubator at 37 °C ...
-
bioRxiv - Pathology 2021Quote: ... or were incubated with Proteinase K (Agilent Dako, S302030-2) for 10 minutes (F4/80).
-
bioRxiv - Pathology 2021Quote: ... or were incubated with Proteinase K (Agilent Dako, S302030-2) for 10 minutes (F4/80).
-
bioRxiv - Neuroscience 2022Quote: ... the slides were air-dried and hematoxylin (Agilent, S330930-2) was added to the slides at RT for 7 min ...
-
bioRxiv - Immunology 2022Quote: ... and glutamine (2 mM) using an XF24 Analyzer (SeaHorse Bioscience). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... or rabbit anti-goat IgG HRP (Agilent technologies/P044901-2) secondary antibodies (1:5000) ...
-
bioRxiv - Cell Biology 2024Quote: ... then blocked with protein-free serum block (Agilent, #X090930-2) for 1 hour and incubated at 4 degrees overnight with the corresponding primary antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... a histological staining with Mayer’s hematoxylin (Dako, cat.no.: S330930-2) followed by Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... EnVision+ Rabbit (K400311-2, Agilent Technologies, Inc., Santa Clara, CA) was used as a secondary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to manufacturer’s protocol with diaminobenzidine (DAB; K346811-2; Agilent) as the chromogen ...
-
bioRxiv - Systems Biology 2023Quote: ... Slides were mounted with Glycergel mounting medium (Agilent # C056330-2) and stored at 4C before imaging ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Hematoxylin and Eosin (H&E) (Agilent Technologies, #CS11830-2) staining was performed using the DAKO CoverStainer ...
-
bioRxiv - Bioengineering 2022Quote: ... A hematoxylin (Cat #K800821-2, Agilent, Santa Clara, CA, USA) counterstain was then applied ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 10mM (Cat No. S236984-2 Agilent, Santa Clara, CA) using Col IV (Sigma Cat# AB769 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Yeast cells were grown in a BioTek Epoch 2 (Agilent) microplate reader to monitor growth at OD630 in three biological replicates.
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM Seahorse XF glutamine solution (Agilent, cat# 103579-100)) on the day of experiment ...
-
bioRxiv - Cell Biology 2023Quote: ... with approximately 10 μL of mounting media (Dako, S302380-2).
-
bioRxiv - Cancer Biology 2023Quote: ... or rabbit anti-mouse IgG HRP (Agilent technologies, P044701-2) at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mm sections were unmasked with PT Link (Dako Agilent Pathology Solutions) at pH 6 or 9 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mm sections were unmasked with PT Link (Dako Agilent Pathology Solutions) at pH 6 or 9 ...
-
bioRxiv - Bioengineering 2021Quote: ... equipped with a 5-Å column (Agilent, 25m x 0.25mm x 30μm).
-
bioRxiv - Physiology 2019Quote: ... PBS-washed sections were blocked with 5% goat serum (Dako, Hamburg, Germany) prior to primary antibody incubation ...
-
bioRxiv - Plant Biology 2019Quote: ... ZORBAX SB-C18 column (5 μm, 9.4 × 250 mm, Agilent 1200, USA) to yield capsidiol (30 mg ...
-
bioRxiv - Biochemistry 2021Quote: ... and an Agilent 5 prep-C18 column (50×21.2 mm; Agilent Technologies). The observed wavelength was 280 nm for TA and 260 nm for GA ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... the 5’ region was then amplified from pMDC43 with Pfu polymerase (Stratagene) and primers MDC43-for and MDC43-rev (Supplemental Table 1) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell counting was conducted using an Agilent BioTek Cytation 5 (Agilent Technologies) imaging system with Gen5 software (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... The signal was detected using a BioTek Cytation 5 imaging reader (Agilent) with the excitation at 360/40 nm and emission at 460/40 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... and a SEC-5 1000 Å guard column (50×4.6 mm, Agilent). Commercial gel filtration standards (Bio-Rad ...