Labshake search
Citations for Agilent :
2551 - 2600 of 5930 citations for Rat N acylethanolamine hydrolyzing acid amidase NAAA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutations were introduced using the M27-QC primers and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent; 210513). Plasmids were integrated via dual transfection with pCAG-SpCas9-GFP-U6-gRNA (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... The total RNA quality was checked with Bioanalyzer (Agilent, RNA 6000 Nano kit, 5067-1511). Small RNA library preparation started with 1ug high quality total RNA ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA integrity was assessed using RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies 5067-1513) and RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770 ...
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 × 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Bioengineering 2022Quote: ... Alanine mutants of LRP6 ectodomain were generated using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: Point mutations were created using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with either the pBRA SP-Tlde1WT plasmid or Tlde1WT pET28b plasmid used as template ...
-
bioRxiv - Cell Biology 2022Quote: ... The R73K mutation was introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). The primer for mutagenesis (AATGCGAGCTATCTTTAATCAAGAAAGTTCCTTCTGGTGCC ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA fragments were tested on a 2100 Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity was checked on the Agilent TapeStation using the RNA Screen Tape kit (Agilent). Total RNA (500 ng ...
-
bioRxiv - Immunology 2022Quote: The Seahorse XF Cell Mito Stress Test Kit (Agilent, Santa Clara, CA; Catalog #103015-100) was run on a Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... samples were run with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA) on the Agilent 2100 Bioanalyzer system (Agilent Technologies ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) to include D614G (ancestral D164G ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Quality of the fragmented RNA was evaluated by the Bioanalyzer pico kit (Agilent Technologies, USA). ~20ng/μl of mechanical extracted RNA were added on a 16S surface probe coated QC array in an in situ cDNA reaction ...
-
bioRxiv - Genetics 2022Quote: ... The primers used for mutagenesis using the Quickchange Lightning mutagenesis kit (Stratagene, La Jolla, CA) are as follows:
-
bioRxiv - Immunology 2022Quote: ... The quality of extracted RNA was assessed using Bioanalyzer and RNA 6000 Nano Kit (Agilent). Gene expression levels were obtained using Human Clariom S arrays on GeneTitan MC Instrument International (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... Silent mutations on TLN1 were generated with the QuikChange site-directed mutagenesis kit (Agilent Technologies) to make our construct resistant against the previously described siRNA specific for TLN1 (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA quality was further assessed using RNA 6000 Pico Kit and Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2022Quote: ... and V3306F were introduced using the Quick-change II Site-Directed Mutagenesis Kit (Agilent, UK).
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries hybridisation was performed as described previously 68 using probes mapping to 122 polycomb target genes promoters and 78 control active gene promoters ...
-
bioRxiv - Neuroscience 2023Quote: ... and quality was checked using a 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent Technologies). Libraries were pooled and sequenced with a NovaSeq 6000 platform (S1 Cartridge ...
-
bioRxiv - Physiology 2023Quote: ... libraries were verified using a Fragment Analyzer and the High Sensitivity NGS kit (Agilent, USA), and quantified using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Physiology 2023Quote: miRNAs were quantified using a Fragment Analyzer and the Small RNA Analysis kit (Agilent, USA). Libraries were constructed using a NEXTFLEX Small RNA-seq v3 kit (Perkin Elmer ...
-
bioRxiv - Immunology 2022Quote: ... RNA integrity was accessed using the RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA). The cDNA libraries were prepared using NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina 96 reactions (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity was checked with the Bionalyzer (agilent 2100 Bioanalyzer, Agilent RNA 6000 nano kit). Five ng of mRNA from each sample were used for retro-transcription ...
-
bioRxiv - Neuroscience 2022Quote: Reverse transcription of RNA was performed using the AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies). Total RNA e (250ng ...
-
bioRxiv - Physiology 2022Quote: ... and the integrity was controlled by gel electrophoresis using a RNA 6000 Nano Kit (Agilent) according to the manufacturer’s protocol using a 2100 Bioanalyzer (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the QuickChange II XL Site Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) and the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... Error-prone PCR was done using Mutazyme PCR from Genemorph II mutagenesis kit (Agilent Technologies) according to the manufacturer’s suggestions ...
-
bioRxiv - Microbiology 2022Quote: ... and an Agilent Femto Pulse system with an Ultra Sensitivity NGS kit (Agilent, FP-1101), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... and quality confirmed with the Agilent 2100 bioanalyzer system and RNA 6000 Pico Kit (Agilent). Depletion of any bacterial or mammalian rRNA and Illumina library preparation for strand-specific RNA-sequencing were then performed by Genewiz ...
-
bioRxiv - Molecular Biology 2022Quote: ... Various point mutant plasmids were prepared using QuikChange II XL site-directed mutagenesis kit (Agilent). QIAprep spin miniprep kit was utilized to make recombinant plasmids following vendor’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Site-directed mutagenesis was achieved by using the “QuickChange II site-directed mutagenesis” kit (Agilent) according to the manufacturers protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and by (2) capillary electrophoresis on Fragment Analyzer (Agilent, HS Large Fragment Kit DNF-493). The quality control of gHMW DNA before degradation showed a DNA concentration of 10 ng/µL ...
-
bioRxiv - Physiology 2022Quote: ... An Iron Stain Kit was used to identify iron pigments (AR15811-2, Artisan, Dako, Agilent) and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2 ...
-
bioRxiv - Physiology 2022Quote: ... An Iron Stain Kit was used to identify iron pigments (AR15811-2, Artisan, Dako, Agilent) and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2 ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pCDNA3.1 was mutated using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies) and NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... or using the RNA 6000 Pico or Nano Kits (Agilent – 5067-1513 and 5067-1511) and an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Cell Biology 2022Quote: ... Site-directed mutagenesis was carried out using QuikChange QuikChange Site-Directed Mutagenesis Kit (Agilent, CA). The primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were tested for mycoplasma contaminants using a PCR-based detection kit (Agilent). LN-95 AR knockout cells were provided by Dr ...
-
bioRxiv - Molecular Biology 2024Quote: ... Site-directed mutagenesis was carried out using Quikchange Lightning Site-Directed Mutagenesis Kit (Agilent, # 210518) (primers in Table S2) ...
-
bioRxiv - Immunology 2024Quote: PCR was carried out with an error-prone polymerase (Agilent, GeneMorph II Random Mutagenesis Kit) to create a randomly mutagenized GP38 library as previously described79.
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis was carried out using a QuickChange II site-directed mutagenesis Kit (Agilent) according to the manufacture’s recommendation ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed by Bioanalyzer using the Agilent RNA 6000 pico kit (Agilent Technologies). mRNAs were further enriched using the NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA quality was assessed using an Agilent RNA6000 Pico Kit on a Bioanalyzer 2100 (Agilent). The library preparation and subsequent analysis were carried out following methods outlined in previous studies53,54 ...
-
bioRxiv - Microbiology 2024Quote: ... performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) followed by transformation of E ...
-
bioRxiv - Biochemistry 2024Quote: ... Site-directed mutagenesis was performed using a QuikChange site-directed mutagenesis kit (Agilent, CA, USA) or KOD -Plus- Mutagenesis Kit (Toyobo ...
-
bioRxiv - Molecular Biology 2024Quote: ... The E549A mutation was introduced using the QuikChange Lightning kit (Agilent, Santa Clara, CA, USA). All cloned constructs and introduced modifications were verified by DNA sequencing ...