Labshake search
Citations for Agilent :
2551 - 2600 of 6604 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... and quality controlled using a Bioanalyser High Sensitivity DNA Analysis kit (Agilent). Twelve liver ATAC-seq libraries arising from 3 biological replicates x 4 time points (T1-T4 ...
-
bioRxiv - Biochemistry 2020Quote: ... were constructed via the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). Expression ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations were introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). A targeting cassette including ∼50 bp homology to the target region on either end was amplified by PCR ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was prepared using miRNA 1-st strand cDNA synthesis kit (Agilent). Mature miRNA sequence and Universal reverse primer (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... using the RNA 6,000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2021Quote: ... For secondary antibody incubation and signal detection LSAB and AEC Kits (DakoCytomation) were used following the manufacturers protocol ...
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...
-
bioRxiv - Immunology 2021Quote: ... and quality checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode (2 x 75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... to generate pScGFPTUB1 using a Stratagene blunt PCR cloning kit (Agilent Technologies). The neomycin (NEO ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated from purified gametocytes using an RNA purification kit (Stratagene). cDNA was synthesised using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... underwent antigen retrieval and were incubated with primary antibodies (KIT, DakoCytomation/Agilent; Ki-67 ...
-
bioRxiv - Biophysics 2020Quote: ... Polymerization interface mutants were generated using a QuikChange Lightning mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... METTL5 mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Library quantification was performed with an Agilent DNA 1000 Kit (Agilent, CA). Template preparation with the DNA library followed by Ion Spheres Particle (ISP ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutants were generated with Quikchange XL kit (Agilent Technologies, Santa Clara, CA) and verified by sequencing.
-
bioRxiv - Neuroscience 2021Quote: ... Overnight IP’s were eluted and purified using Absolutely RNA Nanoprep kit (Agilent). RNA quality was assessed using Nanodrop spectrophotometer and Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP and Secretagogin was performed using the EnVision™ FLEX+ kit (Dako) as detection system and diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by site-directed mutagenesis using the QuickChange II Kit (Stratagene), and verified by sequencing.
-
bioRxiv - Biophysics 2021Quote: ... Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Wilmington, DE), we generated the phosphomimetic Y18E of this tau construct ...
-
bioRxiv - Cancer Biology 2021Quote: ... library size was evaluated using the Bioanalyser High Sensitivity DNA kit (Agilent). Libraries from the same experiment were diluted to 5nM ...
-
bioRxiv - Cell Biology 2021Quote: ... using The Cell Mito Stress Test Kit (Agilent, cat. no. 103015-100). MSCs were seeded at a density of 10,000 cells/well in a XF96 cell culture 96-well microplate (Agilent 101085-004 ...
-
bioRxiv - Cell Biology 2021Quote: ... Each mutation was introduced using QuikChange II site-directed mutagenesis kit (Stratagene). All constructs were Sanger sequenced for verification ...
-
bioRxiv - Physiology 2020Quote: ... and quality checked using a Bioanalyzer High Sensitivity DNA Analysis kit (Agilent); concentration was measured through a qPCR-based method (KAPA Library Quantification Kit for Illumina Sequencing Platforms) ...
-
bioRxiv - Biochemistry 2020Quote: ... equipped with a commercial CE-MS adapter and sprayer kit from Agilent. Prior to use ...
-
bioRxiv - Microbiology 2020Quote: ... RNA profiles were assessed using the Bioanalyzer RNA 6000 Nano kit (Agilent). Ten micrograms of total RNA were converted into cDNA using the SuperScript II cDNA Conversion Kit (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Microbiology 2020Quote: ... This mutation was created with the Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Mutagenesis was performed by PCR using the Quikchange mutagenesis kit (Agilent Technologies) and primers specified in Table S2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and OCR determined using the Seahorse XF Cell Mito Stress Kit (Agilent). Basal respiration was measured in unstimulated cells ...
-
bioRxiv - Cell Biology 2021Quote: ... All stainings were visualized with Horseradish-peroxidase kit (DCS Innovative, Dako, K3468) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and an Agilent RNA 6000 Nano Kit (Agilent Technologies, Loveland, CO, USA). The library was prepared using a TruSeq 3000/4000 SBS Kit ...
-
bioRxiv - Biophysics 2021Quote: Site-directed mutagenesis was executed using the QuikChange Lightning kit from Agilent. HdeA-C18S-C66S was expressed and purified as outlined previously for wild type HdeA [11 ...
-
bioRxiv - Biophysics 2020Quote: ... All mutants were made using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and validated by complete sequencing of the genes encoding for the proteins of interest.
-
bioRxiv - Biophysics 2020Quote: ... Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology). Soluble Sema4D was obtained from R&D Systems Reagents (see Collapse Assay paragraph below).
-
bioRxiv - Biophysics 2021Quote: ... Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA) was used for all mutagenesis ...
-
bioRxiv - Biophysics 2020Quote: ... Single point mutations were generated using QuikChange site-directed mutagenesis kit (Agilent) and majorities of them have been reported in previous publications ...
-
bioRxiv - Cell Biology 2021Quote: ... and quality evaluated using 2100 Bioanalyzer-RNA 3000 Pico Kit (Agilent Technologies), excluding those samples with RIN<5.0 ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from purified gametocytes using an RNA purification kit (Stratagene). cDNA was synthesized using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent). Sequencing was performed using an Illumina NextSeq500 ...
-
bioRxiv - Genetics 2022Quote: PCR products were cloned using StrataClone PCR Cloning Kit (Agilent, Waldbronn, Germany). Positive white colonies were randomly picked and verified with colony PCR ...
-
Computational and functional characterization of the PI(4,5)P2 binding site of the TRPM3 ion channelbioRxiv - Biophysics 2022Quote: ... were generated by the QuikChangeII XL Site-Directed Mutagenesis Kit from Agilent, and the mutated DNA constructs were confirmed by DNA sequencing ...
-
bioRxiv - Genetics 2022Quote: ... the library was prepared with the SureSelect XT HS2 DNA kit (Agilent). We followed the manufacturer’s recommendations (except that initial DNA fragmentation ...
-
bioRxiv - Cell Biology 2022Quote: ... The K44A point mutation was obtained with the Quickchange mutagenesis kit (Agilent) and the following primer set ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA quality was determined using an RNA 6000 Bioanalyzer pico kit (Agilent). A cDNA library was produced using a SMARTer library preparation protocol (Clontech) ...
-
bioRxiv - Biochemistry 2021Quote: ... and the QuikChange II Site-Directed Mutagenesis Kit and protocol (Agilent Technologies). Reaction products were transformed into E ...
-
bioRxiv - Immunology 2020Quote: ... Seahorse XF Mito Fuel Flex Test Kit (Agilent Technologies cat. 103260-100) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and the quality of the libraries were performed on a 2100 Bioanalyzer from Agilent using an Agilent High Sensitivity DNA kit (Agilent P/N 5067-4626). Sequencing libraries were loaded at 10 to 12pM on an Illumina HiSeq2500 with 2 × 50 paired-end kits using the following read length ...