Labshake search
Citations for Agilent :
2501 - 2550 of 4135 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were extracted from sucrose gradient fractions by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... proteins were extracted from the cytosol fraction by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed in TBST and probed with secondary antibodies: anti-rabbit HRP (Dako, P0448, 1:2000) for E-Cadherin and Vimentin ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Genetics 2023Quote: ... We pooled 1 μL of each library and fragment size was assessed with Bioanalyzer 2100 (Agilent™) using the High sensitivity DNA kit (#5067-4626) ...
-
bioRxiv - Genetics 2023Quote: ... Blocking was performed for 1 hour in PBS supplemented with 10% normal goat serum (NGS) (Agilent, X0907). The cells were incubated overnight at 4°C with primary antibodies (Supplementary table 4 ...
-
bioRxiv - Immunology 2023Quote: 1 x 105 BMDMs were seeded in Agilent Seahorse XF24 Cell Culture Microplate (Agilent Technologies, 100777-004) and treated as required by experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp) on a Fragment Analyzer (Agilent). Libraries were quantified by Qubit dsDNA HS Assay (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were further incubated with a goat anti-rabbit HRP-conjugated secondary antibody (1:2000, DAKO) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently incubated with primary antibody solution containing rabbit anti-GFAP [1:500] (DAKO, Z0334) in blocking solution for 24 hr at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Localization of the GFAP was identified using Anti-GFAP (1:500 dilution; Dako Polyclonal Rabbit Z033429-2), followed by rinsing and incubation with a secondary antibody (Alexa-Fluor 488).
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were incubated with a peroxidase-conjugated secondary anti-rabbit antibody (P039901-2, Agilent, 1:3000) for 1h ...
-
bioRxiv - Neuroscience 2024Quote: ... The secondary antibody was added at a 1:2000 final concentration: Goat anti-mouse HRP (P0447; Dako) and goat anti-rabbit HRP (P0448 ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected and filtered with Captiva EMR cartridges (40 mg, 1 mL; Agilent Technologies, Australia) to remove the lipid fraction using a positive pressure manifold (Agilent PPM48 Processor ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μL samples at a concentration of 2 mg mL-1 were injected onto a HPLC (Agilent), equipped with a WTC 015S5 column ...
-
bioRxiv - Pathology 2024Quote: ... 1:300 in PBS and then for 30 min to horseradish peroxidase-conjugated streptavidin (P0397, Agilent Dako) 1:1000 in PBS ...
-
bioRxiv - Pathology 2024Quote: ... 1:300 in PBS and then for 30 min to horseradish peroxidase-conjugated streptavidin (P0397, Agilent Dako) 1:1000 in PBS ...
-
bioRxiv - Immunology 2024Quote: ... the plates were incubated with polyclonal Rabbit Anti-Mouse HRP (1/3000 dilution, Cat. No. P0260, DAKO) for 2 hours at RT ...
-
bioRxiv - Genomics 2024Quote: ... To quality control and quantify libraries 1 ul of cleaned mtATAC library was run on Bioanalyzer (Agilent). mtATAC libraries were sequenced on MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tissue was counterstained with hematoxylin for 1 minute at room temperature (Agilent Technologies-Dako, Cat S330130-2). For IF ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tissue was counterstained with hematoxylin for 1 minute at room temperature (Agilent Technologies-Dako, Cat S330130-2). For IF ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 ml of the purified upper layer was transferred to an amber glass vial (Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... acidified by nitric acid before the measurement of heavy metals by Inductively Coupled Plasma Optical Emission Spectrometer (Agilent ICP-OES 5110, America). The test methods were carried out according to standard protocol(Method of determination for 26 elements (copper ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... segetum to the synthetic mixture of C6-C10 straight chain acids were recorded on an Agilent 7890 gas chromatograph equipped with a flame ionization detector (FID) (Agilent Technologies, USA) and an electroantennographic detector (EAD ...
-
bioRxiv - Systems Biology 2021Quote: ... detected with a diode array detector (DAD G7117A) and quantified following manufacturer’s guidelines (AdvanceBio Amino Acid Analysis, © Agilent Technologies, Inc. 2018). Standards ranging from 5 μM to 30 mM were used for the quantification of aspartate ...
-
bioRxiv - Microbiology 2020Quote: Caprylic acid concentration was quantified by RP-HPLC following Herrera et al.37 using a liquid chromatographer (1220, Agilent Technologies; California, USA) equipped with an Eclipse XDB-C8 5 μm column (150 mm × 4.6 mm i.d.) ...
-
bioRxiv - Cell Biology 2021Quote: ... The upper ether layer was collected and SCFA content was analyzed on an Agilent 7890B gas chromatography system with flame ionization detector using a high-resolution capillary column for detection of volatile acids (DB-FFAP, 30 m x 0.25 mm with 0.25 μm film thickness; Agilent Technologies, Santa Clara, CA). A standard solution containing 10 mM of acetic ...
-
bioRxiv - Plant Biology 2020Quote: ... the HY5 36th Serine (AGC) was changed into Alanine (GCC) and Aspartic Acid (GAC) respectively using Quickchange II site-directed mutagenesis kit (Agilent, Catalog #200523) and cloned into pB7FWG vectors ...
-
bioRxiv - Cancer Biology 2020Quote: ... The concentration of total RNA was measured on a Nanodrop device and the quality of the extracted nucleic acid was assessed using a Bio-analyzer 2100 (Agilent technologies, CA). Microarray probes were synthetized in one cycle of RNA amplification in which molecules were labeled (Affymetrix microarray station ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentration of total RNA was measured using a Nanodrop spectrophotometer and the quality of the extracted nucleic acid was assessed on a Bio-analyzer 2100 (Agilent Technologies, CA). Microarray probes was synthetized by one cycle of RNA amplification in which molecules were labeled in an Affymetrix microarray station (Affymetrix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were resuspended in hexane and fatty acids were separated with gas chromatography (8860 or 7890A GC system, Agilent Technologies, CA, USA) combined with mass spectrometry (5977B or 5975C Inert MS system ...
-
bioRxiv - Systems Biology 2022Quote: ... the RNA integrity number was 10 as assessed by the Stanford Protein and Nucleic Acid (PAN) Biotechnology Facility using the RNA Nano Kit (Agilent #5067-1511) on an Agilent Bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Amino acid substitutions or deletions were introduced into the pSARS-CoV-2-SΔ19 expression vector by site-directed mutagenesis (Stratagene, La Jolla, CA) by following the manufacturer’s instructions and using mutagenic oligonucleotides SaCoV2-K417T-F ...
-
bioRxiv - Cancer Biology 2022Quote: ... RAS double mutants with point-mutations in the 95th and 96th amino acid residues were generated by site-directed mutagenesis (Agilent Technologies #200521) using the primers listed in Supplementary Table 2 per manufacturer’s recommended PCR conditions ...
-
bioRxiv - Physiology 2023Quote: ... High-resolution gas chromatography capillary column coated with 0.25µm film thickness was used (DB-FFAP) for the detection of volatile acids (Agilent Technologies, Santa Clara, CA). The oven temperature was 145°C and the FID and injection port were set to 225°C ...
-
bioRxiv - Microbiology 2023Quote: ... Elemental quantification on acid-digested liquid samples was performed using an Agilent 7700 inductively coupled plasma mass spectrometer (Agilent, Santa Clara, CA). The following settings were fixed for the analysis Cell Entrance = −40 V ...
-
bioRxiv - Biophysics 2024Quote: ... that is loaded onto a Waters HDX-Manager with a desalting flow of 0.23% aqueous formic acid solution (Solvent A) provided by an Agilent 1260 Infinity quaternary pump (Agilent Technologies, CA, USA) and a gradient flow comprised of Solvent A (0.23% aqueous FA solution ...
-
bioRxiv - Microbiology 2024Quote: ... Elemental quantification on acid-digested liquid samples was performed using an Agilent 7700 inductively coupled plasma mass spectrometer (Agilent, Santa Clara, CA). The following settings were fixed for the analysis Cell Entrance = −40 V ...
-
bioRxiv - Cell Biology 2024Quote: ... We mutated the Serine 69 to Alanine (69A) or aspartic acid (69D) using the QuickChange II Site-directed Mutagenesis kit (Agilent Technologies, #200523). The primer for mutating S69-A was ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mm sections were unmasked with PT Link (Dako Agilent Pathology Solutions) at pH 6 or 9 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mm sections were unmasked with PT Link (Dako Agilent Pathology Solutions) at pH 6 or 9 ...
-
bioRxiv - Bioengineering 2021Quote: ... equipped with a 5-Å column (Agilent, 25m x 0.25mm x 30μm).
-
bioRxiv - Biochemistry 2021Quote: ... and an Agilent 5 prep-C18 column (50×21.2 mm; Agilent Technologies). The observed wavelength was 280 nm for TA and 260 nm for GA ...
-
bioRxiv - Microbiology 2021Quote: ... Site-Directed Mutagenesis using the QuikChange II XL kit (Agilent, #200522-5) was performed and the mutations were confirmed by sanger sequencing ...