Labshake search
Citations for Agilent :
2451 - 2500 of 7378 citations for SpectraDye Antibody Labeling Kit IR800 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and Agilent G1607A CE-ESI-MS sprayer kit (Agilent Technologies, Waldbronn, Germany). The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... we used the Low-Input QuickAmp kit (Agilent, Santa Clara, CA, USA). The resulting cRNA was purified using the Absolute RNA Nanoprep kit (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). Libraries were sequenced on a HiSeq 4000 (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries were prepared using the SureSelect XT Library Prep Kit (Agilent) following the manufacturer instructions ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). The libraries were sequenced on an Illumina MiSeq ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and analysis using the Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). High quality samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Developmental Biology 2020Quote: ... Chromogenic detection was implemented with EnVision Detection System-HRP (DAB) kit (Dako).
-
bioRxiv - Systems Biology 2022Quote: ... Sample quality and concentration were assessed by bioanalyzer (High Sensitivity kit, Agilent) and Qubit (Thermofisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCDH15 108N mutations were generated using the QuikChange Lightning mutagenesis kit (Agilent) and mutant protein fragments were expressed and purified identically to the wild-type constructs ...
-
bioRxiv - Genomics 2020Quote: ... with either a high sensitivity or normal D5000 ScreenTape assay kit (Agilent) or Fragment analyzer (AATI) ...
-
bioRxiv - Genomics 2020Quote: ... and quality controlled using a Bioanalyser High Sensitivity DNA Analysis kit (Agilent). Twelve liver ATAC-seq libraries arising from 3 biological replicates x 4 time points (T1-T4 ...
-
bioRxiv - Biochemistry 2020Quote: ... were constructed via the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). Expression ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mutagenesis was carried out using QuikChange Lightning Multi kit (Agilent cat#210515); sequence changes were confirmed by DNA sequencing (Retrogen Inc.) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mutagenesis was performed using the QuikChange Lightning site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: Samples were analyzed by bioanalyzer using DNA-1000 kit (Agilent #5067-1504). Concentration of each library was determined by integrating under the peak of approximately 225-275bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the RNA 6000 Nano Kit (Agilent Technologies; cat. no. 5067-1511).
-
bioRxiv - Genomics 2019Quote: ... RNA profiles were then checked by Bioanalyzer (Agilent RNA 6000 Nano kit) and 1ug of RNA from each condition was used for mRNA-seq ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations were introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). A targeting cassette including ∼50 bp homology to the target region on either end was amplified by PCR ...
-
bioRxiv - Immunology 2019Quote: ... using the Seahorse XF Cell Mito Stress test kit (Agilent, 103015-100). 150.000 peritoneal macrophages and 25.000 primary hepatocytes were plated per well respectively ...
-
bioRxiv - Physiology 2019Quote: ... Quality of RNA was assessed using a RNA nano Bioanalyzer kit (Agilent) using a Bioanalyzer 2100 (Agilent).
-
bioRxiv - Cell Biology 2019Quote: ... while site directed mutagenesis was done using the QuickChange II kit (Agilent). Complex reconfigurations of vector backbones and all point mutations were subsequently verified using standard Sanger sequencing (Macrogen ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified with Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis was performed with the QuikChange site-directed mutagenesis kit II (Stratagene) and successful mutagenesis was confirmed by sequencing ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was prepared using miRNA 1-st strand cDNA synthesis kit (Agilent). Mature miRNA sequence and Universal reverse primer (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... using the RNA 6,000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...
-
bioRxiv - Immunology 2021Quote: ... and quality checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode (2 x 75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... to generate pScGFPTUB1 using a Stratagene blunt PCR cloning kit (Agilent Technologies). The neomycin (NEO ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated from purified gametocytes using an RNA purification kit (Stratagene). cDNA was synthesised using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Biophysics 2020Quote: ... Polymerization interface mutants were generated using a QuikChange Lightning mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... METTL5 mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Library quantification was performed with an Agilent DNA 1000 Kit (Agilent, CA). Template preparation with the DNA library followed by Ion Spheres Particle (ISP ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutants were generated with Quikchange XL kit (Agilent Technologies, Santa Clara, CA) and verified by sequencing.
-
bioRxiv - Neuroscience 2021Quote: ... Overnight IP’s were eluted and purified using Absolutely RNA Nanoprep kit (Agilent). RNA quality was assessed using Nanodrop spectrophotometer and Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP and Secretagogin was performed using the EnVision™ FLEX+ kit (Dako) as detection system and diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by site-directed mutagenesis using the QuickChange II Kit (Stratagene), and verified by sequencing.
-
bioRxiv - Biophysics 2021Quote: ... Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Wilmington, DE), we generated the phosphomimetic Y18E of this tau construct ...
-
bioRxiv - Cancer Biology 2021Quote: ... library size was evaluated using the Bioanalyser High Sensitivity DNA kit (Agilent). Libraries from the same experiment were diluted to 5nM ...
-
bioRxiv - Cell Biology 2021Quote: ... using The Cell Mito Stress Test Kit (Agilent, cat. no. 103015-100). MSCs were seeded at a density of 10,000 cells/well in a XF96 cell culture 96-well microplate (Agilent 101085-004 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... Each mutation was introduced using QuikChange II site-directed mutagenesis kit (Stratagene). All constructs were Sanger sequenced for verification ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were analysed using the Seahorse XF Glycolytic Rate Assay Kit (Agilent) with of 0.5 µM rotenone/antimycin A (Rot/AA ...
-
bioRxiv - Physiology 2020Quote: ... and quality checked using a Bioanalyzer High Sensitivity DNA Analysis kit (Agilent); concentration was measured through a qPCR-based method (KAPA Library Quantification Kit for Illumina Sequencing Platforms) ...
-
bioRxiv - Biochemistry 2020Quote: ... equipped with a commercial CE-MS adapter and sprayer kit from Agilent. Prior to use ...
-
bioRxiv - Microbiology 2020Quote: ... RNA profiles were assessed using the Bioanalyzer RNA 6000 Nano kit (Agilent). Ten micrograms of total RNA were converted into cDNA using the SuperScript II cDNA Conversion Kit (Invitrogen) ...
-
bioRxiv - Plant Biology 2021Quote: ... An RNA Nano 6000 Assay Kit and Bioanalyser 2100 system (Agilent Technologies) were used to assess RNA integrity for RNA-seq analyses ...
-
bioRxiv - Microbiology 2020Quote: ... This mutation was created with the Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...