Labshake search
Citations for Agilent :
201 - 250 of 1644 citations for beta Tubulin III Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA levels were measured by quantitative realtime PCR using Brilliant III Ultra-Fast SYBR Green qPCR mix (Agilent) and 24 ng of cDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The qPCR reaction mixture consisted of 1X Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent), 0.002X reference dye (Agilent) ...
-
bioRxiv - Neuroscience 2024Quote: ... Phosphopeptide enrichment was performed on 5 µL phase Fe(III)– NTA cartridges on an AssayMAP Bravo platform (Agilent) following the immobilized metal affinity chromatography protocol ...
-
bioRxiv - Microbiology 2024Quote: ... 10-µl reactions were prepared with the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent) in technical duplicates for each sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was amplified using the Brilliant III ultra-fast SYBR Green QPCR Master Mix® (Agilent©, #600882) in a 20 µL final volume in 96-well PCR optical plates (Axygen®) ...
-
bioRxiv - Cell Biology 2020Quote: ... or polyclonal rabbit anti-rabbit immunoglobulins/HRP (Dako: Code no. P0448, 1:2000) at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were washed with phosphate-buffered saline (PBS) then incubated with horseradish peroxidase-conjugated rabbit anti-goat or swine anti-rabbit or rabbit anti-mouse antibodies (Dako, Agilent Technologies) and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... The pST39-BLOC-1 plasmid encoding recombinant BLOC-1 was transformed into BL21gold(DE3)plysS cells (230134, Agilent). Several colonies from the plate were inoculated into a starter culture of 10 ml LB supplemented with 34 μg/ml chloramphenicol and 100 μg/ml ampicillin that was grown overnight at 37 °C with moderate shaking ...
-
bioRxiv - Cell Biology 2021Quote: All recombinant proteins were expressed in either BL21-CodonPlus (DE3)-RIPL or ArcticExpress (DE3) competent cells (Agilent Technologies) grown in LB medium overnight at 13-16°C ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins (GST, GST-BZR1, GST-PIF3 and GST-H2A) expressed in BL21- CodonPlus (DE3)-RIL (Agilent Technologies) were purified using glutathione beads ...
-
bioRxiv - Biochemistry 2022Quote: ... goat anti-rabbit and rabbit anti-goat secondary antibodies conjugated to HRP (Dako-Agilent) were used at a dilution of 1:7000 ...
-
bioRxiv - Biochemistry 2022Quote: ... goat anti-rabbit and rabbit anti-goat secondary antibodies conjugated to HRP (Dako-Agilent) were used at a dilution of 1:7000 ...
-
bioRxiv - Neuroscience 2021Quote: ... polyclonal rabbit anti-mouse IgG biotinylated and polyclonal goat anti-rabbit IgG biotinylated (Dako) (IHC ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies HRP-conjugated rabbit anti-mouse and swine anti-rabbit (Dako Cytomation, DK) were used at a 1:10’000 dilution.
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies (rabbit anti-AQP4, 1:500, MerckMillipore; rabbit anti-GFAP, 1:500, Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Goat Anti-Rabbit and Rabbit Anti-Mouse horseradish peroxidase-(HRP) conjugated secondary antibodies (Dako) were used in our experiments.
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA levels were measured by qPCR using the Brilliant III Ultra-Fast qPCR Kit (Agilent Technologies, Cat. #600880) and the StepOnePlusTM qPCR System (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2022Quote: ... qPCR was performed using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, US) following its instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time quantitative PCR (qPCR) was carried out on a Stratagene Mx3005p with Brilliant III SYBR Green kits (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR reactions were performed in duplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) on a C1000 Touch™ thermo Cycler using the CFX96™ Real-Time System (BioRAD ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL template DNA and 10 μL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Santa Clara, CA). PCR was conducted with a Stratagene Mx3005P (Agilent technologies ...
-
bioRxiv - Immunology 2022Quote: ... Each assay was run in triplicate using 15µl of reaction mix containing 7.5ul Brilliant III Ultra-Fast SYBR Green (Agilent Technologies), 500nM forward and reverse primers and 5µl of cDNA (2.5ng of total reverse-transcribed RNA) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Microbiology 2022Quote: ... The quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Immunology 2023Quote: ... Reactions were performed in a 25 μl reaction mix comprising 1X Taqman Brilliant III master mix (Agilent, Stockport, UK), 0.2 pmol/μl forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions contained 10 µL of 2× Brilliant III Ultra-Fast SYBR green QPCR master mix (catalog no. 600882; Agilent), 2 µL each of 2 µM PCR primers (see Table S1 for used primers) ...
-
bioRxiv - Cell Biology 2023Quote: ... or directly processed by RT-qPCR using Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technologies), using primers designed with SnapGene® (version 6.1.1 ...
-
bioRxiv - Systems Biology 2024Quote: ... The qPCR reactions were performed with the Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies, USA) on the Roche LightCycler480 PCR system (1 min 95 °C ...
-
bioRxiv - Genetics 2023Quote: ... Transcript levels were quantified by qPCR using the Brilliant III Ultra-Fast SYBR Green qPCR Master Mix (Agilent Technologies) on a Roche LightCycler 96 Instrument ...
-
bioRxiv - Cancer Biology 2021Quote: ... Rabbit-Mouse kit (Dako, Denmark). Sections were counterstained with haematoxylin (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: Rabbit anti-GFAP (Z0334, Dako) 1:200
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-HBcAg (B0586, DAKO), mouse anti-HA-tag (sc-7392 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-GFAP (Agilent; RRID:AB_10013482), Alexa Fluor 647 isolectin GS-IB4 (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or anti-rabbit (Dako, P0448)) ...
-
bioRxiv - Systems Biology 2019Quote: ... and rabbit anti-lysozyme (Dako), followed by Alexa Fluor-488 and −594 conjugated secondary antibodies (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit and Rat respectively (Agilent) for 30 min at RT (anti-SARS-CoV ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti C3 antibody (DAKO) 1:200 for 20 minutes at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... HRP-anti-rabbit (Dako, P0448).
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-ubiquitin (1,000, Dako). The primary antibodies were visualized with Alexa Fluor 488 or Alexa Fluor 568 goat anti-rabbit IgGs (1:200 ...
-
bioRxiv - Physiology 2021Quote: ... rabbit anti-Ubiquitin (Dako, Z0458) and rabbit anti-CHOP (Santa Cruz ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-rabbit HRP (both DakoCytomation) secondary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit normal IgG (DAKO, X0903), mouse normal IgG (Southern Biotech ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit anti-GFAP (policolonal, Dako), rabbit anti-Nestin (policolonal ...
-
bioRxiv - Neuroscience 2020Quote: ... or rabbit (1:2,000, Dako) was applied for 1 hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-S100β (Dako, IS504), mouse anti-tyrosinated tubulin (Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-MAPT (Dako, A0024), mouse anti-p-T231 (AT180 ...
-
bioRxiv - Pathology 2020Quote: ... rabbit polyclonal (Dako, cat#Z0622)) diluted in NGS at a concentration of 1:200 and 1:100 ...
-
bioRxiv - Physiology 2021Quote: ... rabbit anti-Ubiquitin (Dako, Z0458), rabbit anti-HMGB1 (Abcam ...