Labshake search
Citations for Agilent :
201 - 250 of 887 citations for QuantiQuik L Lactic Acid Quick Test Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Triplicate reactions were set up in Semi-skirted 96-Well PCR Plates (0.2 ml) with optical strip caps (Agilent). The PCR reactions were carried out in an AriaMx Real-time PCR System (Agilent) ...
-
bioRxiv - Immunology 2022Quote: ... The labeling efficiency was determined using instant thin-layer chromatography on silica gels chromatography strips (ITLC-SG; Agilent Technologies) using 0.1 M sodium citrate buffer ...
-
bioRxiv - Genomics 2019Quote: ... with Low Input Quick Amp Labeling protocol (Agilent Technologies cat.# 5190-2331) and the Cy3 fluorophore ...
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...
-
bioRxiv - Genetics 2019Quote: The mlh3-D1185N mutation was introduced into pEAE397 by Quick Change (Agilent) to create pEAE413.
-
bioRxiv - Microbiology 2019Quote: ... and labelled using the Low Input Quick Amp WT Labelling kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and V987P were introduced using a Quick change multi-mutagenesis kit (Agilent) for spike protein stabilization15 ...
-
bioRxiv - Microbiology 2021Quote: ... and V987P were introduced using a Quick change multi-mutagenesis kit (Agilent) for stabilization of recombinant spike protein (Yurkovetskiy et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Site-directed mutagenesis was achieved using a Quick-Change kit (Stratagene, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The labeling reactions were performed using a Quick Amp Labeling kit (Agilent). The Cy3-labeled cRNAs were fragmented and hybridized to the microarray slides at 65°C for 17 h ...
-
bioRxiv - Biochemistry 2023Quote: ... Single point mutation R416A was introduced through the Quick-Change kit (Stratagene) in order to induce monomerisation of the protein.48 The NP H17N10 gene from little yellow-shouldered bat/Guatemala/060/2010(H17N10 ...
-
bioRxiv - Cell Biology 2021Quote: ... OCR and ECAR were measured using Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies). 1 × 104 cells/well were plated onto 7 μg/mL Poly-D-Lysine coated (Ruhanen et al ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial function was assessed using a Seahorse XF24 cell MitoStress Test (Agilent Technologies, California, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Cellular OCR and ECAR were analyzed using the Mito Stress Test Kit (Agilent Technologies, 103015) at the following drug concentrations ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Seahorse XF Cell Mito Stress test was performed on a Seahorse XFe96 Analyzer (Agilent) in the XF Base Medium (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... were measured using a Mitochondrial Stress Test assay as per manufacturer’s instructions (Agilent, 103015-100).
-
bioRxiv - Cell Biology 2021Quote: Assays were performed using a Seahorse XF96 Cell Mito Stress Test Kit (Agilent Biosciences, USA). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... Mitochondrial respiration parameters were measured using the mitochondrial stress test kit (Seahorse Bioscience, 103015-100), by sequentially adding oligomycin (2 μM) ...
-
bioRxiv - Genetics 2021Quote: ... All compounds were from a Seahorse XF Cell Mito Stress Test Kit (Agilent, 103015-100). Four OCR measurements were recorded for baseline and following each injection ...
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 x 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Cancer Biology 2022Quote: Oxidative respiration was measured using XF Cell Mito Stress Test Kit (Agilent Technologies, 103015-100). 1 × 104 cells per well were seeded on an XF96 Cell Culture Microplate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 ng of genomic DNA from the test samples and human reference DNA (Agilent Technologies) were differentially labeled with Cy5-dCTP and Cy3-dCTP by random priming ...
-
bioRxiv - Immunology 2022Quote: The Seahorse XF Cell Mito Stress Test Kit (Agilent, Santa Clara, CA; Catalog #103015-100) was run on a Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Immunology 2022Quote: ... glycolytic agents (Seahorse Bioscience Cell Glycolysis Stress Test, Agilent #103017-100, Santa Clara, CA, USA) were utilized at 10 mM D-glucose ...
-
bioRxiv - Neuroscience 2022Quote: Mitochondrial stress test was performed using Seahorse XFp Extracellular Flux analyzer (Agilent, Santa Clara, CA), according to manufacturer protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... OCR was measured by a Seahorse XF96e FluxAnalyzer with the Mito Stress Test kit (Agilent). The Mito Stress Test inhibitors were injected during the measurements as follows ...
-
bioRxiv - Immunology 2023Quote: The Seahorse XF Cell Mito Stress Test Kit (Agilent, Santa Clara, CA; Catalog #103015-100) was run on a Seahorse XFe96 Bioanalyzer (Agilent ...
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... seeded (25,000-50,000 cells/well) on Matrigel coated test plates (Extracellular Flux Assay Kit, Agilent) and cultured 4 days in maturation medium prior to measurement ...
-
bioRxiv - Neuroscience 2023Quote: This test was run in accordance with the manufacturer’s instructions (catalogue # 103020-100, Agilent, UK). Following the initial baseline reads ...
-
bioRxiv - Cancer Biology 2024Quote: Mitochondrial stress test was performed using a Seahorse Bioscience XF96 Extracellular Flux Analyzer (Seahorse Bioscience). 104 cells were seeded in Seahorse XF96 V3 PS cell culture microplates and grown overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Seahorse XF Glycolysis Stress Test (without sodium pyruvate or glucose, Agilent 103020-100) were then performed ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutants were generated according to the Quick-Change site-directed mutagenesis protocol (Stratagene).
-
bioRxiv - Plant Biology 2021Quote: ... with the Quick Change Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Cat #210518). Similarly ...
-
bioRxiv - Neuroscience 2020Quote: ... the Quick Change Lighting MultiSite-directed Mutagenesis kit (Agilent Technologies, Les Ulis, France) was used and the primers were as follows ...
-
bioRxiv - Biochemistry 2022Quote: ... Quick-Change kit was used as indicated by the manufacturer (Agilent Technologies, USA). Full plasmid with CaMDR1 gene was amplified by using pre-designed primers harboring the desired mutation ...
-
bioRxiv - Microbiology 2019Quote: ... The Quick Change XL Site-directed mutagenesis kit (Stratagene, San Diego, California, USA) was used to generate the phosphomimetic KSRP-S193D-HA and non-phosphorylable KSRP-S193A-HA proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... Site-directed mutagenesis reactions were performed by Quick-Change site-directed mutagenesis (Stratagene). All cloning and mutagenesis reactions were verified on a 3130 XL sequencer (Applied Biosystems).
-
bioRxiv - Genetics 2022Quote: ... K286Ter mutations were generated with the Quick Change Mutagenesis Kit (Agilent Technologies #200517). Human TDP-43 fused to pCherry was described previously10.
-
bioRxiv - Plant Biology 2022Quote: ... was generated with the Quick-Change Lightning Site-Directed Mutagenesis Kit (Agilent Technologies).
-
bioRxiv - Biophysics 2023Quote: ... site-directed mutagenesis was performed using Quick Change II XL kit (Agilent Technologies) using the primers listed in Table S3 ...
-
bioRxiv - Microbiology 2023Quote: Individual alleles of natT were constructed using the Quick-Change mutagenesis protocol (Stratagene) with Phusion DNA polymerase (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 μM FCCP was added to port A (Agilent Seahorse XFp cell mito stress test kit) and 1.4 μM rotenone/antimycin A in port B (Agilent Seahorse XFp cell mito stress test kit) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Extracellular flux analysis was performed using the Seahorse XF Cell Mitochondrial Stress Test kit (Seahorse Bioscience) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Quantification of the parameters generated in each test were performed using the formulas provided by Agilent. Data represented as ECAR/OCR fold change were normalized to the average ECAR/OCR of control unstimulated BMDMs.
-
bioRxiv - Neuroscience 2021Quote: ... Mitochondrial oxygen consumption rate was analysed using the Seahorse XF Cell Mito Stress Test Kit (Agilent) with 1μM oligomycin ...
-
bioRxiv - Immunology 2020Quote: ... was used following the manufacturer’s instructions for XF Cell Mito Stress Test Kit (103015-100, Agilent). In this test ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial respiration was measured using Agilent’s Cell Mitochondrial Stress Test kit (Agilent Technologies, PN: 103015-100) and Seahorse XFe24 Analyzer ...
-
bioRxiv - Cancer Biology 2020Quote: ... ECAR was detected using Seahorse XF Glycolysis Stress Test kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s handbook ...
-
bioRxiv - Biochemistry 2020Quote: Mitochondrial respiration was evaluated using the Seahorse XFe Cell Mito Stress Test Kit (Agilent #103015-100) following the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Extracellular flux analysis was performed using the Seahorse XF Cell Mitochondrial Stress Test kit (Seahorse Bioscience) according to the manufacturer’s protocol ...