Labshake search
Citations for Agilent :
201 - 250 of 1488 citations for Mouse IRX6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... goat anti-mouse (P447 DAKO, 1:2000) and rabbit anti-goat (P449 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-mouse HRP secondary (DAKO K400111-2), OPAL TSA 520 (Akoya # FP1487001KT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Goat anti-mouse immunoglobulins/HRPs (Dako #P0447) (used 1:500-1:5,000) ...
-
bioRxiv - Cancer Biology 2022Quote: ... goat anti-mouse (1:10000, #P0447, Agilent) or anti rabbit (1:10000 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-mouse and anti-goat antibodies (Dako) were diluted 1:10,000 in 1% BSA/PBST ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... anti-mouse (Dako P044701-2; 1:1000) Alexa Fluor 488 or anti-rabbit (#1706515 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated with polyclonal mouse (DAKO; P0447), or rabbit (DAKO ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse IgG-HRP (Dako, P0447, 1/1500) and rabbit IgG-HRP (Dako ...
-
bioRxiv - Pathology 2023Quote: ... Envision mouse/rabbit HRP (DAKO, Glostrup, Denmark) was used in the secondary detection step ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-mouse (diluted 1:5000) (Dako, P0260), anti-rabbit (diluted 1:5000 ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit/Mouse (Agilent, Santa Clara, California, USA), and counterstained using haemalum ...
-
bioRxiv - Cancer Biology 2024Quote: ... or mouse EnVision+ System HRP (K4007, Dako) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... mouse α-human CD20 (clone L26, Dako), rabbit α-CD3 (SP7 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP-coupled anti-mouse IgG (DakoCytomation, #P0447), HRP-coupled anti-rabbit IgG (DakoCytomation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Goat anti-mouse HRP (P044701, DAKO Agilent), 1:5000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Goat anti-mouse HRP (P044701, DAKO Agilent), 1:5000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP-coupled anti-mouse IgG (Dako; #P0447). After washing in TBST ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Cancer Biology 2024Quote: ... HRP-conjugated rabbit/mouse secondary antibody (Agilent) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid for overexpression of the M495L mutant was prepared by Quickchange (Stratagene) mutagenesis of the pET28b-MtbRho plasmid encoding WT MtbRho (kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were cloned into pSC-A-amp/kan Strataclone plasmids (Agilent) to generate probes for wholemount in situ hybridization experiments (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid was transformed into XL10 gold competent E.coli cells (Agilent). Plasmids for transfection were prepared by Midi-preps (QIAGEN ...
-
bioRxiv - Molecular Biology 2019Quote: Plasmids were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent #NC9122855), and single colonies were grown as overnight cultures in 5 mL terrific broth (TB ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids pET21b containing corresponding genes were transformed into BL21 (DE3) Gold (Agilent). For GyrA ...
-
bioRxiv - Genetics 2020Quote: ... The plasmid was subcloned into pIRES-1a-hrGFP (Stratagene; San Diego, CA) plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... High concentration plasmid solutions were produced using XL1-Blue Competent Cells (Agilent) and plasmid extraction was performed using Qiagen Plasmid Maxikit (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... The plasmids were transformed into Escherichia coli strain BL21 (DE3) RIL (Stratagene). Expression was induced at 16 °C overnight with 0.2 mM of IPTG ...
-
bioRxiv - Biochemistry 2020Quote: ... the pFR–Luc and pFA2– cJun plasmids from Stratagene (now, Agilent Technologies), and the pRL–SV40 plasmid from Promega ...
-
A rare variant on a common risk haplotype of HFE causes increased risk of hereditary hemochromatosisbioRxiv - Genetics 2019Quote: ... This plasmid was mutated with a Quikchange Lightning Multi-site kit (Agilent) to create C282Y ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mutant plasmids for yeast promoter analyses were constructed by Quikchange mutagenesis (Stratagene) following adaptation for use of Phusion DNA polymerase (NEB ...
-
Identification of a motif in Trm732 required for 2’-O-methylation of the tRNA anticodon loop by Trm7bioRxiv - Genetics 2021Quote: ... Plasmids expressing Trm732 and THADA variants were generated by quickchange PCR (Stratagene) or Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR products were cloned into pCMV-3XFlag plasmid (Agilent Technologies, USA). To generate a GFP-LC3-RFP autophagic flux reporter construct ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified DNA was cloned into the GST-pGEX-2TK plasmid (Stratagene). GST-FHA fragment was expressed into E.coli BL21PlysS at 30°C for 4h ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting plasmids were inserted into XL10-Gold ultracompetent cells (#200314, Agilent) via heat shock as indicated by the provider and extracted with standard Miniprep (#K0503 ...
-
bioRxiv - Biophysics 2024Quote: Each GαS plasmid was transformed into BL21-CodonPlus (DE3)-RIL cells (Agilent) and the bacteria were grown at 30 °C in M9 medium (50 mM Na2HPO4 ...
-
bioRxiv - Physiology 2023Quote: ... The DNA plasmids were treated with Dpn I restriction enzyme (Agilent Technologies) to digest the methylated parental DNA template and subsequently transformed into XL10-Gold competent cells (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: Mutations to plasmids were created with Quikchange II site-directed mutagenesis kit (Agilent). Sequences for primers used in mutations are found in table S1.
-
bioRxiv - Microbiology 2019Quote: ... Point mutations were introduced into plasmid-encoded viral cDNAs using QuikChange mutagenesis (Agilent) according to the manufacturer’s protocol.
-
Vasohibin1, a new IRES trans-acting factor for sequential induction of angiogenic factors in hypoxiabioRxiv - Cell Biology 2019Quote: ... VEGFA or EMCV IRESs was cloned in pSCB-A-amp/kan plasmid (Agilent) downstream from the T7 sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids were constructed using Gibson Assembly and cloned using XL1-BLUE (Agilent Technologies) E ...
-
bioRxiv - Cancer Biology 2020Quote: ... S838A/T841A substituted plasmid was made with QuikChange Site-directed mutagenesis kit (Agilent), following manufacturer’s recommendations and mutagenic primers TTAGTATCAATTGGTGAAGCATTCGGGGCTTCT GAGAAGTTCCAGAAA and TTTCTGGAACTTCTCAGAAGCCCCGAATGCTT CACCAATTGATACTAA ...
-
bioRxiv - Biophysics 2020Quote: Plasmids were transformed into BL21-CodonPlus(DE3)-RIPL competent cells (Agilent Technologies #230280). A single colony was inoculated in 1 mL of terrific broth (TB ...
-
bioRxiv - Microbiology 2020Quote: ... and all remaining plasmids were generated through site-directed mutagenesis (QuickChange Lightning, Agilent) or cut- and-paste cloning ...
-
bioRxiv - Biochemistry 2021Quote: pMtac expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Expression of His6-tagged proteins were induced at 16°C overnight with 0.25 mM IPTG ...
-
bioRxiv - Neuroscience 2022Quote: ... the plasmid was transformed into BL21-CodonPlus (DE3)-RIPL competent cells (Agilent, #230280). A single colony was inoculated in 1-mL TB medium (Laboratory ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transformed and expanded in XL10-Gold Escherichia coli strain (Stratagene). The cDNA of the plasmid was sent for Sanger sequencing to validate the gene sequence.
-
bioRxiv - Immunology 2021Quote: ... Mutant virus Env plasmid was generated by Quikchange site-directed mutagenesis kit (Agilent) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... plasmid pDG2 (PapCHis) was mutated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) and the primers listed in Extended Data Table 3 ...
-
bioRxiv - Immunology 2020Quote: ... and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent) using GeneJammer (Agilent) in 10% FBS/DMEM enriched with 1% Pennicilin/Streptomycin (D10 medium) ...