Labshake search
Citations for Agilent :
201 - 250 of 1828 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Neuroscience 2024Quote: ... Bluing Buffer (Agilent; CS70230-2) was applied to each tissue section until covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Genetics 2024Quote: ... high 9 (Agilent, K800421-2). Sections were immunostained in AutostainerLink 48 from Agilent with EnVision Detection System Peroxidase/DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM glutamine (Agilent)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 μl of 2 – 4 mg/ml protein samples were applied to a column using the 1260 Infinity HPLC system (Agilent Technologies) coupled to a MiniDawn Treos detector (Wyatt Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... Parkin mutant plasmids were cloned beginning with a Homo sapiens wild type eGFP-parkin vector [36] and performing PCR point mutagenesis (Quikchange Mutagenesis kit: Stratagene) utilizing primers ordered from Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Amino acid substitutions or deletions were introduced into the pSARS-CoV-2-SΔ19 expression vector by site-directed mutagenesis (Stratagene, La Jolla, CA) by following the manufacturer’s instructions and using mutagenic oligonucleotides SaCoV2-K417T-F ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... The 75th amino acid in the PB1-F2 protein was changed to a histidine (H) via site directed mutagenesis (QuikChange Lightning, Agilent) to produce the PB1-F2-75H plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... and fluorenylmethoxycarbonyl (FMOC) was based on the application note “Automated amino acids analysis using an Agilent Poroshell HPH-C18 Column” by Agilent. The samples were injected onto a 100 mm x 3 mm InfinityLab Poroshell HPH-C18 column (2.7 μm ...
-
bioRxiv - Biochemistry 2020Quote: E.coli expression plasmids encoding GST-PEX14-NTD with amino acid substitutions were constructed via Site Directed Mutagenesis using QuikChange II (Stratagene). ß-tubulin (amino acids 388–444 ...
-
bioRxiv - Microbiology 2020Quote: ... The 13C-labeling patterns of proteinogenic amino acids were determined on a 6890N Network GC system with a 5975 inert XL mass selective detector (Agilent Technologies Inc. ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2020Quote: The mCherry-TRAK1 deletion mutant mCherry-TRAK1Δ was obtained by inserting a stop codon after amino acid 635 of the mCherry-TRAK1 encoding nucleotide sequence by means of a PCR-based mutagenesis (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene). The GFP-Rem-T7 partial deletion mutants (GFP-RemΔ103-155-T7 ...
-
bioRxiv - Physiology 2022Quote: ... This construct has an artifactual amino acid change in its coding sequence (I143V) and site-directed mutagenesis (Quikchange II XL, Agilent) was performed to convert it back to WT with following two primers (all primers were ordered from Integrated DNA Technologies):
-
bioRxiv - Neuroscience 2024Quote: ... Point amino acid substitutions in genes encoding GluN subunits were performed using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequencing.
-
bioRxiv - Microbiology 2023Quote: Binding of VHHs to spike proteins on the surface of mammalian cells was determined by flow cytometry using pcG1-expression plasmids containing the coding sequence of the SARS-CoV-2 spike protein from which the C-terminal 18 amino acids were deleted and in which the D614G substitution was introduced by QuickChange site-directed mutagenesis (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The substitution of amino acids via SDM was carried out using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... were designed to replace the relevant amino acid residue with alanine and carried out using the PfuUltra II Fusion HS DNA Polymerase kit (600670, Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The site-directed mutants of PtPelA and PaPelA without its predicted signal sequence (amino acids 47-948 for PaPelA; accession Q9HZE4) were generated using the QuikChange Lightning site-directed mutagenesis kit (Stratagene). The sequence of all vectors was confirmed using DNA sequencing.
-
bioRxiv - Biochemistry 2024Quote: The Pol β proteins were transformed and expressed in BL21-CodonPlus (DE3)-RP Escherichia coli (E. coli) competent cells (Agilent). The transformed cells were grown at 37 °C to an OD600 of 0.6 and Pol β expression induced using 0.1 mM isopropyl-b-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... The optical purity of L-lactic acid and D-lactic acid were measured via a HPLC system (Agilent 1260 series, Hewlett-Packard, USA) equipped with a SCAS Sumichiral OA-5000 column (150 × 4.6 mm ...
-
bioRxiv - Immunology 2024Quote: ... Stimulated BMDMs were washed with XF media (non-buffered RPMI-1640 containing 2 mM L-glutamine and 1 mM sodium pyruvate; Agilent Seahorse XF24) and incubated for 1 hour at 37°C ...
-
bioRxiv - Immunology 2022Quote: FFPE tissue sections were deparaffinized and antigen retrieval was undertaken in 0.1 M citric acid buffer solution (Dako, target retrieval solution, S169984-2) using an electric pressure cooker (Russell Hobbs RHNHP401) ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid substitutions were introduced using a QuikChange II XL site directed mutagenesis kit (200521) purchased from Agilent (Santa Clara, CA). After transformation into BL21-Gold (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids harboring GlnR amino acid substitutions (pET28a-glnR derivatives) were constructed using site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Agilent, Inc.).DNA fragments consisting of different canonical GlnR-dependent promoters (narG whose downstream genes encoding M ...
-
bioRxiv - Immunology 2022Quote: Biotinylated MHC monomers with human β2-microglobulin specific for H-2Ld β-galactosidase (TPHPARIGL) were obtained from the NIH Tetramer Core Facility and tetramerized with streptavidin-PE (Prozyme). Decoy reagent was made according to published protocols (20) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent). Variants of the wild type sigAP and sigAP”ext-10” (harboring the T-17G-16T-15G-14 motif ...
-
bioRxiv - Microbiology 2024Quote: ... was added to a final concentration of 10 mg/mL and β-Galactosidase activity was measured by OD420 using a plate reader (BioTek Cytation 1 Cell imaging reader, Agilent) β-Galactosidase activity units are defined as (µmol of ONP formed min-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Horseradish peroxidase (HRP)-conjugated secondary antibodies were from Dako (cat # P026002-2 and cat # P021702-2) and detected using either SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific ...