Labshake search
Citations for Agilent :
201 - 250 of 1254 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The purified libraries were quantified using qPCR based on the qPCR Quantification Protocol Guide (KAPA) and qualified using the Agilent Technologies 4200 TapeStation (Agilent technologies). The libraries were subsequently sequenced using the HiSeq platform (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR was performed with Thunderbird SYBR qPCR mix (Toyobo) in Stratagene MX3000P real-time qPCR system (Agilent Technologies). The transcript levels were calculated with standard curve method and normalized by that of internal control PROTEIN PHOSPHATASE 2A-3 (PP2A3)69 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The qPCR reactions were performed with SsoAdvanced™ Universal SYBR® Green Supermix in a Stratagene Mx3005P qPCR System (Agilent Technologies) with an optimized dilution of cDNA (accessed via dilution series for each oligo pair) ...
-
bioRxiv - Microbiology 2021Quote: ... IL17A and IL23 using Affinity QPCR cDNA Synthesis kit and Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix as per kit instructions (Agilent Technologies Inc. ...
-
bioRxiv - Molecular Biology 2021Quote: PFDN5 ORF (splice variant alpha) was cloned EcoRI/SalI into pCMV-Tag 2A (N- terminal Flag tag, Agilent) or XhoI/EcoRI into pEGFP-C1 (N-terminal GFP tag ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Plant Biology 2023Quote: ... Primers were designed according to the Quickchange II manual (Agilent) so that the forward and reverse primers were complementary to each other ...
-
bioRxiv - Immunology 2023Quote: ... site-directed mutagenesis using specific primers was performed (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Amplifications were performed on Mx3005P qPCR System apparatus with the help of the MxPro qPCR Software 4.0 (Stratagene, La Jolla, CA, U.S.A.). For each transcript ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were performed in an Mx3005P qPCR System with the help of the MxPro qPCR Software 4.0 (Stratagene, La Jolla, CA, USA). EF was used as the endogenous control (ID ...
-
bioRxiv - Molecular Biology 2022Quote: Pre-multiplexed ATAC-seq DNA was diluted to 0.5 ng/uL and qPCR analysis of chromatin accessibility was performed by running 3uL of DNA on a Mx3005P qPCR platform (Stratagene/Agilent, Stockport, UK) with Brilliant II Sybr green reaction mix (Stratagene/Agilent ...
-
bioRxiv - Cell Biology 2024Quote: qPCR was performed using 2× SYBR Green qPCR Mix (Low ROX) (Aidlab Biotechnologies, Beijing, Chian) in a Stratagene Mx3000P (Agilent Technologies, SUA). With GAPDH mRNA as endogenous control ...
-
bioRxiv - Neuroscience 2020Quote: ... The quality of the libraries is determined using the Standard High sensitivity NGS Fragment analysis kit (DNF-474, 1-6000 base pair) on the Agilent Fragment analyzer (Agilent, USA), yielding approximately 260 bp size fragments ...
-
bioRxiv - Bioengineering 2020Quote: ... yielding library sizes with an average distribution of 500-750 base pairs in length as determined using the Agilent hsD1000 Screen Tape System (Agilent Genomics). Arrays were sequenced within multi-sample pools on an Illumina Nova-Seq through the Broad Institute walk-up sequencing core ...
-
bioRxiv - Neuroscience 2021Quote: ... The quality of the libraries is determined using the Standard High sensitivity NGS Fragment analysis kit (DNF-474, 1-6000 base pair) on the Agilent Fragment analyzer (Agilent, USA), yielding approximately 260 bp size fragments ...
-
bioRxiv - Microbiology 2023Quote: ... Microtiter plates containing technical replicates for each antibiotic-berberine pair were incubated for 18 hours with vigorous shaking using in Cytation5 Imaging Reader (Agilent BioTek). OD600 values were recorded every 15 minutes and select time points (0 ...
-
bioRxiv - Biophysics 2021Quote: ... The data was acquired with MxPro QPCR software (Agilent) and analysed with DSF Analysis v3.0.1 tool (ftp://ftp.sgc.ox.ac.uk/pub/biophysics ...
-
bioRxiv - Plant Biology 2020Quote: ... qPCR was performed on Stratagene Mx3000P (Agilent Technologies, California) using the Lightcycler 480 SYBR Green I Master Mix (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... using Brilliant III UltraFast SYBR QPCR Master Mix (Agilent). Primers are listed in Supplemental Table 2 ...
-
bioRxiv - Immunology 2020Quote: ... using Brilliant II SYBR Green QPCR Master Mix (Agilent), followed by ViiA 7 RUO Software for the determination of Ct values ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Mx3000P qPCR System (Agilent, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: One-step Brilliant II RT-qPCR core kit (Agilent) was used for quantitative analysis of extracted HIV RNA ...
-
bioRxiv - Pathology 2021Quote: ... using Brilliant III Ultra-Fast QPCR Master Mix (Agilent) following the supplier’s recommendations (5 μl DNA at 10 ng μl-1 in a total reaction volume of 20 μl) ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were run on Mx3005P qPCR System (Agilent Technologies) containing 10 ng RNA sample ...
-
bioRxiv - Microbiology 2021Quote: ... using Brilliant II SYBR Green qPCR Mastermix (Agilent Technologies) and the primers Bac8Fmod (5’-AGA GTT TGA TYM TGG CTC AG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... and using the qPCR reagents (Agilent Technologies, Cat# 600882). GAPDH served as normalizing gene and the relative mRNA levels of target genes were calculated by 2−ΔΔCT method ...
-
bioRxiv - Cancer Biology 2020Quote: ... and running on an MX3000p qPCR system (Agilent Technologies) with standard cycling setup.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were dispensed into 96-well qPCR plates (Agilent) in replicates of six ...
-
bioRxiv - Genomics 2022Quote: ... The library was quantified by qPCR (MxPro, Agilent Technologies) using the KAPA Library Quantification Kit for Illumina Libraries (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... on the MX3000p qPCR detection system (Stratagene, Agilent Technologies). Primers (Supplementary Table II ...
-
bioRxiv - Cell Biology 2023Quote: ... on the MX3000p qPCR detection system (Stratagene, Agilent Technologies). Primers (Supplementary Table II ...
-
bioRxiv - Cell Biology 2022Quote: ... using Brilliant II SYBR Green QPCR Master Mix (Agilent). Results were analysed by the comparative Ct method using ViiA 7 RUO software ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed using Brilliant II SYBR Green (Agilent) and pre-designed primers
-
bioRxiv - Microbiology 2023Quote: ... The RT-qPCR was run on a Mx3000P (Agilent) using an annealing temperature of 60°C and analyzed against a standard curve of Mitochondrial 18S ribosomal RNA (RRN18S ...
-
bioRxiv - Physiology 2024Quote: ... Proline point mutations were made in the Nav1.5 alpha subunit with the QuikChange II site-directed mutagenesis kit (Agilent) and primers from Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: Pre-multiplexed ATAC-seq DNA was diluted to 0.5 ng/uL and qPCR analysis of chromatin accessibility was performed by running 3uL of DNA on a Mx3005P qPCR platform (Stratagene/Agilent, Stockport, UK) with Brilliant II Sybr green reaction mix (Stratagene/Agilent ...
-
bioRxiv - Genomics 2020Quote: ... Final library quality control consisted of confirmation of amplification and barcoding by SYBR Green-based RT-qPCR (Stratagene Mx3005P QPCR System, Agilent, Santa Clara, CA), visualization on a 2% agarose E-Gel (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and hypoxanthine guanine phosphoribosyl transferase (HPRT) were assessed by quantitative reverse transcription polymerase chain reaction (RT-qPCR, Mx3005P QPCR System (Agilent, Santa Clara, CA). After 24 or 48 h of incubation in normoxia ...
-
bioRxiv - Genetics 2024Quote: ... RT-qPCR was done with a Agilent AriaMX qPCR machine according to the protocol for Brilliant II SYBR QPCR Low ROX Mstr Mx (Agilent, catalog number 600830). IKZF1 qPCR primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Expression analysis was performed by quantitative real-time PCR (qRT-PCR) using a Stratagene® Mx3005P® qPCR System instrument and Brilliant III SYBR Green qPCR Master Mix with Low ROX (Agilent Technologies). The reaction was prepared with each primer (0.5 μL ...
-
bioRxiv - Immunology 2021Quote: ... mouse anti-human CD3 (Dako) and mouse anti-HIV-1 P24 (Dako) ...
-
bioRxiv - Immunology 2021Quote: ... FITC anti-human CD44 (DAKO), Purified NA/LE mouse anti-human CD253 (BD Biosciences) ...
-
bioRxiv - Microbiology 2020Quote: Universal Human Reference RNA (Stratagene) was treated with RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD8 (DAKO), and mouse anti-human TAG72 (AB16838 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD3 (DAKO), mouse anti-human CD4 (DAKO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD4 (DAKO), mouse anti-human CD8 (DAKO) ...
-
bioRxiv - Immunology 2023Quote: ... For human CD45 (Dako, M0701), CD19 (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human universal total RNA (Agilent) was used as a positive control ...
-
bioRxiv - Genomics 2021Quote: ... the sgRNA locus was amplified using primers and Herculase II (Agilent) with 20 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Primers for mutagenesis were designed using online tools provided by Agilent. WT MEN1 plasmid was used as a template ...