Labshake search
Citations for Agilent :
201 - 250 of 2729 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and applied for 45 minutes at room temp ...
-
bioRxiv - Physiology 2022Quote: ... Primary antibodies were diluted in antibody diluent (Dako) and incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and a droplet of 25 µl or 50 µl applied on the sample for an 8-well or a coverslip upside down ...
-
bioRxiv - Neuroscience 2024Quote: ... Antibodies were diluted in antibody diluent (Dako, S0809) containing 0.3% Triton X-100 and incubated overnight at 4 °C in a humidified chamber ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were diluted in Antibody Diluent (Dako) and incubated overnight at 4 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... Sample fractions were continuously collected into 96 well plates by an Agilent 1100 Series Micro-FC G1364D micro fraction collector (Agilent Technologies, Germany). For each sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... Non-specific protein binding was then blocked with a serum-free protein block solution (Agilent X090930-2) and 5% BSA in 1x TBS-T ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). A chemiluminescence substrate (West Dura ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in antibody diluent (Agilent; #S3022) and incubated with sections for 16 hours at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were diluted in Background Reducing Antibody Diluent (Agilent) and subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies diluted in antibody diluent (S080983-2, Dako) were applied on sections for overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary Antibodies: anti-human CD41 antibody (Agilent, F708801-2) and alpha tubulin antibody (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibody staining in Background-Reducing Antibody Diluent (Agilent) with appropriate serum overnight at 4°C in a humid chamber ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked (30 min, protein block X0909, Dako), and stained overnight at 4°C using primary antibodies detecting F4/80 ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Serum-Free Protein Block (DAKO, X0909) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were diluted in Dako Real Antibody Diluent (Dako, S2022). Staining was performed on the BenchMark XT immunostainer (Ventana Medical Systems).
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated on sections overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... primary antibodies were typically diluted in antibody Diluent (DAKO, S2022) with 2% milk (v/v ...
-
bioRxiv - Neuroscience 2023Quote: Anti-iba1 microglial antibody (AlphaLaboratories) or anti-GFAP antibody (Agilent) were used with biotinylated polyclonal goat anti-rabbit immunoglobulin secondary antibodies (Dako ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Ubiqutin (Dakocytomation); Cdc53/yCul1 (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD3 antibody (Dako M725429-2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Secondary antibodies (DAKO) specific for rabbit or mouse were applied ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies were diluted as indicated in the antibody section in Background Reducing Antibody Diluent Solution (ADS)(DAKO). Cover slips were placed growth surface down onto a 50 ml drop of staining solution on parafilm in a humidified chamber and incubated overnight at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were probed using species-specific HRPconjugated secondary antibodies (Dako) and viewed using a Chemidoc imager (BioRad).