Labshake search
Citations for Agilent :
201 - 250 of 3100 citations for 6 Cyclopentadecen 1 one 3 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Bioengineering 2021Quote: ... Antigen retrieval was performed using citrate-based pH 6 antigen retrieval solution (Dako) for 1 min at 120°C and allowed to cool to 90°C in a decloaking chamber ...
-
bioRxiv - Genomics 2022Quote: ... RNA quality (RNA integrity number > 6) was confirmed via Fragment Analyzer (Agilent, USA). RNA was treated with DNase I and reverse-transcribed using SuperScript III (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2019Quote: pTrex-6×His-TOP1Y723F was generated by QuikChange II XL SDM kit (Agilent) using oligonucleotides 5’-CTAGGGTCCAGAAAATTGAGTTTGGAGGTTCCCAGG-3’ pTrex-6×His-TOP1 K117 ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 ng of total RNA was labeled with the one-color Quick Amp labeling kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2021Quote: ... DNA sequences of ONE-seq libraries were synthesized on high-density oligonucleotide chips (Agilent Technologies; G7238A, G7222A). Oligonucleotide libraries were made double stranded by limited cycle PCR-amplification with primers oKP535 and oKP536/oKP577 (Supplementary Table 7) ...
-
bioRxiv - Plant Biology 2019Quote: ... At least one sample for each organ was run on a RNA Pico Bioanalyzer microfluidics chip (Agilent) to calculate RNA integrity numbers (RIN) ...
-
bioRxiv - Microbiology 2021Quote: ... The quality and integrity of RNA samples was assessed using Nanodrop ONE and Agilent Bioanalyser (Agilent 2100) and only samples with RIN > 6.0 ...
-
bioRxiv - Biophysics 2019Quote: ... The signal offset signal was measured by one of oscilloscopes and the PMT voltage adjusted by Agilent U2351A DAQ (Keysight) ...
-
bioRxiv - Biophysics 2020Quote: ... The signal offset signal was measured by one of oscilloscopes and the PMT voltage adjusted by Agilent U2351A DAQ (Keysight).
-
bioRxiv - Biochemistry 2023Quote: ... One µL of liquid solvent sample was injected in splitless mode with an autosampler (Model G4513A, Agilent). Column flow was kept constant at 2.5 mL min−1 with He as a carrier gas ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Immunology 2019Quote: ... or low pH antigen retrieval buffer (Dako Target retrieval Solution, pH 6, Dako, Denmark) (for PCNA) ...
-
bioRxiv - Immunology 2021Quote: ... mouse thymocytes were exposed to 254 nm UV-irradiation for 6 minutes (Stratagene Stratalinker) followed by labelling with 2 μM CFSE (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... the heat-induced antigen retrieval was performed in Target Retrieval solution (pH 6) (Dako) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: Heat-induced antigen retrieval was performed in either Target Retrieval solution (pH 6) (Dako) or in EDTA (pH 8.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was carried out using citrate buffer solution pH 6 (Dako, Glostrup, Denmark). Detection was performed using the EnVision method (Dako ...
-
bioRxiv - Microbiology 2019Quote: All experiments were performed with a one-step enzymatic kit in a Stratagene Mx3005P qPCR system (Agilent Technologies). For this experiment Brilliant III ultra-fast qRT-PCR master mix (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... and Cy3-labeled cRNAs were synthesized using the Low Input Quick Amp Labeling kit (one-color, Agilent Technologies). Labeled probes were purified with RNeasy kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... One hour before the start of the experiment we replaced culture medium with XF Assay Medium (Agilent Technologies) pH7.4 ...
-
Metabolic switching and cell wall remodelling of Mycobacterium tuberculosis during bone tuberculosisbioRxiv - Microbiology 2022Quote: ... tuberculosis RNA was accomplished using One-Color Microarray-Based Low Input Quick Amp WT Labelling kit (Agilent Technologies) as per the manufacturer’s protocol using 300ng of input RNA ...
-
bioRxiv - Immunology 2020Quote: cDNA was synthesized by using the AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, US) using extracted RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Nanodrop One and RNA integrity was quantified with the Agilent 4200 Tapestation (Agilent Technologies, Santa Clara, CA). Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... Total RNA from each extraction was quantified using a NanoDropTM One spectrophotometer and integrity analysed using a Bioanalyzer (Agilent) with the RNA 6000 Nano kit ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random nonamer primers ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Molecular Biology 2023Quote: ... One µL of the library was analyzed on an Agilent 2100 Bioanalyzer using a High Sensitivity DNA chip (Agilent) to assess product profiles and concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...