Labshake search
Citations for Agilent :
201 - 250 of 3693 citations for 3 1 Pyrrolidinylmethyl phenyl magnesium bromide solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... RNA concentration was measured by Nanodrop and 1 to 3 μg of RNA was reverse transcribed with AffinityScript Multi-Temp RT (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subjected to antigen retrieval antigen retrieval (pH = 6.0 for cleaved caspase-3 and pH = 9.0 for cleaved PARP-1) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Neuroscience 2021Quote: ... free floating sections were blocked with 3% donkey serum and incubated overnight with either rabbit anti-GFAP (1:10000, Dako), rat anti-CD68 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Neuroscience 2021Quote: ... and were then incubated in a solution containing mouse antibody anti-Aβ (clone 6F/3D; 1:50, Dako M0872, Glostrup, Denmark). The sections were then processed with a secondary biotinylated horse anti-mouse IgG antibody (1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... The sulfo-SANPAH solution was placed on gels and activated using 1 Joule of 254 nm UV light (Stratagene UV crosslinker). Afterwards ...
-
bioRxiv - Cancer Biology 2020Quote: ... paraffin-embedded sections were treated with Instant Citrate Buffer Solution (RM-102C, LSI Medicine) or Target Retrieval Solution (S1699, Dako) as appropriate to retrieve antigen ...
-
bioRxiv - Pathology 2022Quote: ... and then incubated in DAB solution (DAKO, #K0679) for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and treated with antigen retrieval solution (Dako, S1699). Sections were blocked using a blocking buffer (1% BSA and 2% FCS in PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...
-
bioRxiv - Pathology 2023Quote: ... in Target Retrieval Solution pH 9.0 (S2367, DAKO). The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001 ...
-
bioRxiv - Pathology 2023Quote: ... in Target Retrieval Solution pH 9.0 (S2367, DAKO). The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001 ...
-
bioRxiv - Immunology 2024Quote: ... diluted in Antibody diluent solution (Dako, S080983-2) overnight at 4ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution High pH (Agilent Cat#GV80411-2), 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution Low pH (Agilent Cat#GV80511-2), Retrieval Solution High pH (Agilent Cat#GV80411-2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed once with Rinse solution (Dako) at room temperature for 10 seconds ...
-
bioRxiv - Molecular Biology 2023Quote: ... Parasites were washed in 1X Wash Solution (Dako) and incubated for 10 min at 40 °C ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mM Pyruvate Solution (103578-100, Agilent Technologies,), 20 μM MitoParaquant (MitoPQ ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine solution (cat 103579-100) (Agilent). Neuron cultures were transferred to a non-CO2 incubator for 1 hour prior to running the assay ...
-
bioRxiv - Cell Biology 2024Quote: ... with 100 mM Pyruvate Solution (Agilent, 103578-100), 1 M Glucose Solution (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by blocking with protein block solution (Dako) for 3 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... heat-mediated antigen retrieval (target retrieval solution, Dako) was performed ...
-
bioRxiv - Systems Biology 2024Quote: ... All solutions were made using DMEM (from Agilent) supplemented with 1% FBS ...
-
bioRxiv - Microbiology 2024Quote: ... solution in EnVision FLEX Peroxidase Blocking reagent (Dako) was also used to eliminate endogenous peroxidase activity within the mosquitoes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and serum-free protein block solution (Agilent; #X0909) followed by overnight incubation in primary antibodies (anti-GFP 1:400 ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were bleached with H2O2 solution (#S2023; Dako) for 5 min ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Biochemistry 2020Quote: ... All aqueous solutions in this assay were manipulated by a Velocity 11 Bravo liquid handler (Agilent Automation Solutions, Santa Clara, CA). The final volume in the assay plate was 25 ul ...
-
bioRxiv - Immunology 2022Quote: ... the tissue sections for IMC were heat pre-treated using a target retrieval solution for 30 min at 95°C (K8000, EnVision flex target retrieval solution, pH9 (Agilent Technologies). Slides were cooled down for 20 min at room temperature before rinsing with water and PBS ...
-
bioRxiv - Neuroscience 2023Quote: Vibratome cut (free floating) tissue was heated to 70°C in 1x Daco Target Retrieval solution (DakoTarget Retrieval Solution, pH 6.1, Dako, code. S2367) for 15 min and left to cool at room temperature (RT) ...
-
bioRxiv - Systems Biology 2023Quote: ... HIER was done by submerging in EnVision FLEX Target Retrieval Solution High pH solution (diluted to 1X) (Agilent Dako, cat.no. K8004) and heating in a steamer at 95°C for 20 min ...
-
bioRxiv - Systems Biology 2023Quote: ... HIER was done by submerging in EnVision FLEX Target Retrieval Solution High pH solution (diluted to 1X) (Agilent Dako, cat.no. K8004) and heating in a steamer at 95°C for 20 min ...
-
bioRxiv - Physiology 2021Quote: ... Primary antibodies are diluted in 1x blocking solution and incubated with antibodies against insulin (1:2000, guineapig, Dako, cat. no. A-0546), glucagon (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Wildtype mouse brain paraffin sections were used for IHC analysis with a dilution of mouse serum at 1:200 with antibody diluent solution (DAKO, S080983-2). Mouse anti-NMDAR1 monoclonal antibody (BD ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...