Labshake search
Citations for Agilent :
201 - 250 of 4747 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... ‘Normal’ block (Agilent Cat#S202386-2), EnVision FLEX TRS High pH (Agilent Cat# GV80411-2) ...
-
bioRxiv - Neuroscience 2024Quote: ... Tau Dako (Agilent Technologies, #A002401-2), C-Myc (Cell Signaling Tech ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM glutamine (103579; Agilent Technologies) and 1 mM sodium pyruvate (103578 ...
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Herc II polymerase (Agilent), and 35 µl nuclease-free water were added to the 40 µl gDNA ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Genomics 2022Quote: ... Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was removed from each well and then each section was washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM glutamine (Agilent 103579-100), and 10 mM glucose (Agilent ...
-
bioRxiv - Genomics 2024Quote: ... Citrate pH 6 (Dako, S236984-2) at 100°C for CD206 and CD86 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Microbiology 2021Quote: Headspace CO concentrations were monitored every 2-4 days using an Agilent 6890N gas chromatograph (GC; Agilent Technologies, California, US) equipped with a nickel catalyst methaniser (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Immunology 2024Quote: ... and 2-3 x 105 NK cells per well were seeded in triplicates in Seahorse XF RPMI medium (Agilent, 103576-100) supplemented with 2 mM L-glutamine (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 μ M FCCP and 1 μM rotanone/antimycin A (Agilent Seahorse #103015-100). Calculated oxygen consumption rates were determined as per the manufacturer’s instructions (Mitochondrial Stress Test ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse blood was diluted at 1:200 with antibody diluent solution (DAKO, S080983-2) as the primary antibodies for IHC on wildtype mouse brain paraffin sections ...
-
bioRxiv - Immunology 2024Quote: ... 1-2 x 105 cells were seeded in XF96 cell culture microplates (Seahorse Bioscience). The Sensor Cartridge was prepared according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... was diluted to 1:2000 in Dako Env FLEX Ab diluent (K800621-2, Dako) for 30 mins ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with 1:2000 horseradish peroxidase goat anti-mouse secondary antibody (Agilent #P044701-2) for 1 hour at RT in TBST with 5% (w/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies (HRP linked) were swine anti–rabbit (P039901-2) and goat anti–mouse (P044701-2) (DAKO). Imaging was done using SuperSignal West Femto (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biophysics 2020Quote: ... They were then stained for 5 min with 4,6-diamidino-2-phenylindole (DAPI) and mounted using fluorescence mounting medium (DAKO, Agilent). Pictures were taken with an UltraVIEW ERS spinning disk confocal microscope (Zeiss 63X/1.4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 384-well plates on 5 μL scale reactions using 2 μL diluted cDNAs and Brilliant III Ultra-fast SYBR Green qPCR Master Mix (Agilent) with primers listed in Table S7 at a final concentration of 0.4 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Biochemistry 2024Quote: ... The plates were then shaken for 2 minutes and luminescence was measured using the BioTek Cytation 5 cell imaging multimode reader (Agilent).
-
bioRxiv - Neuroscience 2024Quote: ... Chromogen development was performed using a 10 min incubation followed by 5 min water rinse and a 10 min counterstain with Dako EnVision Flex hemotoxylin (K800821-2, Dako). Slides were transferred to Sakura Prisma Autostainer for dehydration and coverslipping.
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit TMEM119 at 1:500 (ab185333, Abcam, mouse PG-M1 at 1:400 (GA61361-2, Dako Omnis, Agilent), mouse P2RY12 at 1:1000 (ab180366 ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit TMEM119 at 1:500 (ab185333, Abcam, mouse PG-M1 at 1:400 (GA61361-2, Dako Omnis, Agilent), mouse P2RY12 at 1:1000 (ab180366 ...
-
bioRxiv - Immunology 2024Quote: ... Primary antibodies against human CD3 (1:100; #A045229-2) and CD68 (1:400; #M0876) were obtained from Dako, UK ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were centrifuged at 20.800 xg for 2 min and 100 µl sample was injected on a SEC-HPLC column (Bio SEC-3 300 Å, Agilent, USA) using an Agilent 1260 Infinity II system (Agilent ...
-
bioRxiv - Genetics 2021Quote: ... Samples with a 260/280 nm absorbance ratio > 1.8 and a 260/230 nm absorbance ratio > 2 were labeled and hybridized to the Tomato Gene Expression Microarray 4 × 44K (Agilent Technologies) as previously described (Coppola et al. ...
-
bioRxiv - Microbiology 2020Quote: ... for 2hrs at 40°C and then incubated over-night at 4°C on a rotating wheel with 2 μg of anti HBc antibody (Dako B0586). Immune-complexes were captured with protein A/G magnetic beads ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 μl of 2 – 4 mg/ml protein samples were applied to a column using the 1260 Infinity HPLC system (Agilent Technologies) coupled to a MiniDawn Treos detector (Wyatt Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... at 4°C overnight followed by incubation with Dako EnVision+System-HRP Labelled Polymer Anti-Mouse (Aglient Dako, Cat # K400111-2) for 60 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.
-
bioRxiv - Plant Biology 2024Quote: ... Oligosaccharides were reductively aminated with 2-aminobenzoic acid (2-AA) and cleaned using a GlycoClean S cartridge (ProZyme) as previously described (Tryfona & Stephens ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (Seahorse®, Agilent) in a CO2 free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Bluing buffer (Agilent Technologies; Cat # CS703230-2) was then added to the slide until the sections were completely covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... rabbit polyclonal anti-tau (Agilent, A002401-2) at a 1:3000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3E: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM glutamine (Agilent Technologies, 103579-100), and 10 mM glucose (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli SURE 2 Supercompetent cells (Stratagene, USA) for clonal selection and amplification ...
-
bioRxiv - Genomics 2020Quote: ... and FISH Wash Buffer 2 (Agilent, G9402A) at room temperature for 1 min ...
-
bioRxiv - Molecular Biology 2020Quote: The yeast strain YRG-2 (Stratagene, USA) containing the HIS3 and lacZ reporter genes was used to test transcriptional activation activity ...
-
bioRxiv - Physiology 2021Quote: ... with hematoxylin counter stain (Agilent, S330130-2) was used to visualize positive stain ...
-
bioRxiv - Cell Biology 2020Quote: ... Guinea Pig anti-Insulin (Dako IR00261-2) and mouse anti-TAF4 (TAF II p135 ...