Labshake search
Citations for Agilent :
2401 - 2450 of 5958 citations for Rat IL 3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Samples quality assessment/size was validated by Bioanalyzer DNA-High sensitivity kit (Agilent # 5067-4626).
-
bioRxiv - Microbiology 2019Quote: ... and libraries were prepared using the SureSelect Automated Library Prep Kit (Agilent, Santa Clara, USA). Index tagged samples were amplified using KAPA HiFi DNA polymerase ...
-
bioRxiv - Cancer Biology 2019Quote: ... AGO2Y393F mutant construct was generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) from the FH-AGO2 plasmid described above using the primers hAGO2_Y393F_Fwd 5’AAATTCACGGACGAATGGATCTGTGTTGAAACTTGCAC3’ and hAGO2_Y393F_Rev 5’GTGCAAGTTTCAACACAGATCCATTCGTCCGTGAATTT3’ ...
-
bioRxiv - Plant Biology 2019Quote: ... The probes were prepared using Prime-It® Rm T Random Primer Labeling kit (Stratagene). The probe for AtMIOX4:pBIB-Kan was amplified with npt-II forward (5’-AGA GGC TAT TCG GCT ATG AC-3’ ...
-
bioRxiv - Neuroscience 2019Quote: ... and RNA quality was assessed using the Bioanalyser (Agilent RNA 6000 Pico kit; #5067-1513). The libraries were prepared using 0.5-2 ng of non-cerebellum microglia RNA samples with RIN value ≥ 7 and cerebellar microglia with RIN value ≥ 6 ...
-
bioRxiv - Genomics 2019Quote: ... and library qualification and quantification reagent using Bioanalyzer High Sensitivity Kit was purchased from Agilent. NextSeq 500/550 kit for short read sequencing was purchased from Illumina.
-
bioRxiv - Biochemistry 2019Quote: Site-specific mutagenesis was performed using the QuikChange™ Site-Directed Mutagenesis Kit from Stratagene. All mutants were confirmed by sequencing of plasmid DNA at Eurofins MWG Operon (Ebersberg ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The cDNA libraries were prepared using SureSelect Strand Specific RNA Library Preparation Kit (Agilent Technologies) and RNA and cDNA qualities were assessed using BioAnalyzer Kits (Agilent Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Site mutagenesis of RBOHC and RBOHD was performed with a QuickChange Kit (Agilent Technologies; 210518). The indicated proteins were incubated in protein kinase assay buffer (20 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Microbiology 2021Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... Modifications of these plasmids were made using the QuikChange Lightning site-directed mutagenesis kit (Agilent). The C-termini were tagged with mGFP or mCherry to facilitate protein localization ...
-
bioRxiv - Cell Biology 2020Quote: ... and R784A were introduced into pHalo-NM2C using QuikChange site-directed mutagenesis kit (200524; Agilent).
-
bioRxiv - Genomics 2021Quote: ... WGS libraries were quality controlled with the high-sensitivity DNA kit on the Bioanalyzer (Agilent), selecting for size distributions of 300bp to 1kb and concentrations over 1 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using SYBR Green One-Step (Kit# 600825, Agilent, Santa Clara, CA). qRT-PCR data were analyzed using the Sequence Detection System software (SDS Version 2.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality check was performed using a Fragment Analyzer (HS NGS Fragment kit, Agilent, DNF-474). Further ...
-
bioRxiv - Cancer Biology 2020Quote: ... Labeled cRNA were prepared from total RNA using the Agilent’s Quick Amp Labeling Kit (Agilent). Following fragmentation ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... RNA quality was then assessed using a eukaryote total RNA Nano 6000 Kit (Agilent Technologies) prior to high depth RNA sequencing or microarray analysis and qRT-PCR.
-
bioRxiv - Neuroscience 2021Quote: ... Mutations were introduced by use of the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer using the Agilent QuikChange Primer Design tool for primer design.
-
bioRxiv - Neuroscience 2021Quote: ... Final RNA quality and integrity were assayed using the DNA 12000 kit on Bioanalyzer (Agilent). Further ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality of RNA extracts was assessed on the Bioanalyser using the RNA pico kit (Agilent). Samples with RIN value higher than 8 were processed using the NEBNext poly(A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The quality of the libraries was assessed with the Bioanalyzer High Sensitivity DNA kit (Agilent). The libraries were quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs ...
-
Scanning mutagenesis of RNA-binding protein ProQ reveals a quality control role for the Lon proteasebioRxiv - Microbiology 2021Quote: Libraries of ProQ mutants were generated by using GeneMorph II EZClone Domain Mutagenesis Kit (Agilent). As template ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were tested for mycoplasma using the PCR based mycoplasma detection kit (Agilent).
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries’ quality and quantity were verified with a High-Sensitivity DNA Kit (Agilent Technologies, USA) on a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... using Agilent DNA screentape D1000 kit on a TapeStation (Agilent Technologies, Santa Clara, CA, USA), the hybridization steps were performed using exome capture probes and streptavidin coated beads ...
-
bioRxiv - Cell Biology 2021Quote: ... OCR and ECAR were measured using Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies). 1 × 104 cells/well were plated onto 7 μg/mL Poly-D-Lysine coated (Ruhanen et al ...
-
bioRxiv - Cell Biology 2021Quote: ... product size distribution and quantity were assessed on a Bioanalyzer High Sensitvity DNA Kit (Agilent). The amplified cDNA (200 ng ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by a DAB revelation of few seconds (DAKO DAB Kit, #K346811-2, Agilent, France). Free-floating sections were mounted on gelatine-coated slides ...
-
bioRxiv - Biochemistry 2020Quote: ... All point mutations were generated by the Quick Change site-directed mutagenesis kit (Agilent, CA) and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cellular OCR and ECAR were analyzed using the Mito Stress Test Kit (Agilent Technologies, 103015) at the following drug concentrations ...
-
bioRxiv - Cell Biology 2021Quote: ... The latter was further subjected to site-directed mutagenesis using QuikChange Lightning kits (Agilent Inc.).
-
bioRxiv - Microbiology 2020Quote: ... and an Agilent 2100 Bioanalyzer with an RNA 6000 Nano LabChip kit (Agilent Technologies, Ltd.). All the samples displayed a 260/280 ratio greater than 2.0 and RNA integrity numbers (RIN ...
-
bioRxiv - Plant Biology 2020Quote: ... and subsequently subjected to site-directed mutagenesis (QuikChange XL Site-Directed Mutagenesis Kit, Agilent Technologies) according to manufacturer’s instructions to introduce the mutations F4E or V11E (primer pairs vipp1-F4E-1 + vipp1-F4E-2 and vipp1-V11E-1 + vipp1-V11E-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... pDONR P2R-P3-PrKAI2d3 was mutated with the QuikChange II site directed mutagenesis kit (Agilent). The generated clones were checked by sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent), following the respective manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... A Nano 6000 Assay Kit was used with a 2100 BioAnalyzer® system (Agilent©) revealed that all sample RIN scores were over 9.0 (Supplementary Fig ...
-
bioRxiv - Microbiology 2020Quote: ... The profiles before and after rRNA depletion were analysed with RNA 6000 pico kit (Agilent) with a 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2021Quote: ... Cy3-labeled cRNA was prepared using a Low Input Quick Amp Labeling Kit (Agilent Technologies), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were analysed using the Bioanalyzer (High Sensitivity Kit, Agilent Genomics, Santa Clara, CA, USA) and Qubit (dsDNA HS Assay Kit ...
-
bioRxiv - Systems Biology 2020Quote: ... mitochondrial stress test was performed using a Seahorse XF Cell Mito Stress Test kit (Agilent) according to the manufacture manual ...
-
bioRxiv - Biochemistry 2021Quote: ... Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). All constructs were verified by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Mutant F14 expression vectors were constructed with QuikChange II XL Site-Directed Mutagenesis kit (Agilent), using primers containing the desired mutations and C-terminal TAP-tagged codon- optimised F14 cloned into pcDNA4/TO as template ...
-
bioRxiv - Molecular Biology 2020Quote: ... p53/pET28a plasmid was then templated in Quickchange Lightning Site-Directed mutagenesis kit (Agilent Technologies) to create the desired mutations in p53-(1-73 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Site directed mutagenesis was performed via the QuikChange Lightning kit (Agilent, Santa Clara, CA, USA) according to the vendor’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... an Advanced Analytical FEMTO Pulse instrument (Genomic DNA 165 kb Kit; FP-1002-0275, Agilent) and a deNovix DA-11 Series ...
-
bioRxiv - Microbiology 2020Quote: ... The average size of the library was determined by the High Sensitivity DNA Kit (Agilent) and the Library Quantification Kit – Illumina/Universal Kit (KAPA Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was prepared from extracted RNA using the AffinityScript QPCR cDNA Synthesis Kit (600559, Agilent). PCR reactions for each sample were performed in triplicate with specific primers using iQ SYBR Green Supermix (1708887 ...
-
bioRxiv - Microbiology 2019Quote: ... and RNA Nano 6000 Assay Kit with the Bioanalyzer 2100 system (Agilent Technologies, CA, USA), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... in vitro site directed mutagenesis was performed using QuikChange site directed mutagenesis kit (Stratagene, USA) using manufacturers protocol ...