Labshake search
Citations for Agilent :
2351 - 2400 of 5728 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:10 and 1:50 dilutions of the library on a Bioanalyzer High sensitivity DNA Chip (Agilent) and running it on Bioanalyzer 2100AB (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were seeded at 50,000 cells/well (~80-90% confluent when assayed) in a 24-well Agilent Seahorse XF Cell Culture Microplate (Seahorse Bioscience) and incubated overnight at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were seeded in complete growth medium on a Seahorse XF Cell Culture Microplate (Agilent Technologies, Santa Clara, CA, USA) to reach 90% monolayer confluence by the next day ...
-
bioRxiv - Cancer Biology 2021Quote: PaTu-8902 iDox-shGOT2.1 cells that had been cultured in 1 μg/mL doxycycline for 3 days were seeded at 2×104 cells/well in 80 μl/well of normal growth media in an Agilent XF96 V3 PS Cell Culture Microplate (Agilent). To achieve an even distribution of cells within wells ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were split with EDTA and 5×104 cells per well were seeded on Seahorse XF24 cell culture microplates (Agilent) 24 h before the experiment ...
-
bioRxiv - Cell Biology 2021Quote: ... wild-type and porthos KD cells were seeded at 10 × 105 cells per well in Seahorse XF96 polystyrene tissue culture plates (Agilent) and incubated in unbuffered Seahorse RPMI assay medium (Agilent ...
-
bioRxiv - Biochemistry 2022Quote: ... 12 × 103 cells per well were reverse transfected with siRNA control or targeting SORD in a Seahorse XF24 Cell Culture Microplate (Agilent) with MEM Alpha adjusted to 10 mM glucose ...
-
bioRxiv - Microbiology 2022Quote: ... cell nuclei and LCMV NP expression in infected cells were detected by Gen5 software (Agilent Technologies, Santa Clara, CA, USA). Infection was calculated as the fraction of infected cell.
-
bioRxiv - Molecular Biology 2019Quote: ... Then the cells were seeded in the DMEM medium on Seahorse XF96 V3 PS cell culture microplates (Seahorse XFe96 FluxPak mini, Agilent) coated with 0.1 % gelatine 24 h before the experiment ...
-
bioRxiv - Physiology 2019Quote: Both control and VDR-KD cells were seeded in XFe24-well cell culture microplates (Seahorse Bioscience, North Billerica, MA, USA) at 3.0 × 105 cells/well in 100 μl of growth medium ...
-
bioRxiv - Molecular Biology 2021Quote: Primary brown adipose cells were isolated and cultured for 3 days before plated in XF cell culture microplates (Seahorse Bioscience). Cells (10,000 cells ...
-
bioRxiv - Immunology 2022Quote: ... CD45RA+ naive cells were separated from the CD45RO+ memory T cells by positive selection of memory T cells using CD45RO-Phycoerythrin antibody (DAKO) and magnetically-labeled anti-PE beads (Miltenyi Biotec) ...
-
bioRxiv - Immunology 2022Quote: ... Seahorse XF Cell Culture Microplates were pre-treated with poly-D-lysine and 106 primary B cells or 105 DG75 cells were plate in Seahorse XF Base Medium (Agilent) supplemented with 2mM L-glutamine (Agilent) ...
-
bioRxiv - Immunology 2022Quote: Sorted CD8 T cells were seeded into poly-l-lysine pre-coated wells of a 96-well plate (XFe96 cell culture microplates, Agilent) and incubated at 37°C for 1 h before the plate was placed into an Extracellular Flux Analyzer XFe96 (Seahorse ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Developmental Biology 2024Quote: The cells (H9, CS and CFS) were dissociated using TrypLE select and seeded in cell culture microplate (Agilent Seahorse XF96) at a density of 50000 cells/well in presence of their full respective media ...
-
bioRxiv - Immunology 2024Quote: ... ex-vivo derived bovine and human MØ were matured as described above and seeded at a density of 1.5 x 105 cells in 180 µl in XFe cell culture microplates (Agilent, USA). Cells were stimulated with LPS (1 ng ml-1 ...
-
bioRxiv - Cancer Biology 2023Quote: The metabolic profile of 1205Lu melanoma cells was assessed using the Seahorse XF Cell Energy Phenotype Test Kit (Cat no.103325-100, Agilent). Both parental and NKX2.2 KO 1205Lu cells ...
-
bioRxiv - Biochemistry 2023Quote: ... drugs were added at the indicated concentration in triplicate and the cell index was measured over a period of 48-96 h (Real Time Cell Analyzer, Agilent).
-
bioRxiv - Pathology 2023Quote: ... the effect of conditioned media from Hep3B cells on cell adhesion was evaluated after 24 h of exposure with the xCELLigence System (Agilent,), using phorbol myristate acetate (PMA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 HO-1 +/+ and HEK293 HO-1 -/- were seeded at a density of 2.5 × 104 cells/well on a poly-D-lysine (#P6407-5MG) coated Seahorse XF96/XF Pro cell culture microplate (#204624-100, Agilent) on the day prior to the analysis ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were mounted with mounting medium (Dako, Denmark) and analysed by confocal microscopy using an SP5 AOBS confocal microscope (Leica Microsystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell glycolysis Test Kit (Agilent, 103020), was used for the assay ...
-
bioRxiv - Cell Biology 2020Quote: BL21-CodonPlus®(DE3)-RP competent cells (Agilent) were transformed with the expression vectors pGEX-4T1 expressing GST-Trim39 fusion proteins (WT and mutants) ...
-
bioRxiv - Cell Biology 2019Quote: ... One Agilent cell culture miniplate (Agilent Cat. #102984) was coated with Corning Cell-Tak Cell and Tissue Adhesive (Corning Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Seahorse XF Cell Mito Stress kit (Agilent Technologies) was used according to manufacturer’s instructions and modified for zebrafish purposes as described in previous publications [80–82] ...
-
bioRxiv - Biophysics 2022Quote: ... coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies) was induced with 1 mM IPTG and continued for 3 h at 37 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... VP cells were washed (Dako wash buffer, Dako) and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako ...
-
bioRxiv - Developmental Biology 2019Quote: ... VP cells were washed (Dako wash buffer, Dako) and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako ...
-
bioRxiv - Microbiology 2019Quote: ... coli XL-10 GOLD ultracompetent cells (Agilent Technologies). The plasmids were transfected into RD cells using Lipofectamine LTX (life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... coli BL21-CodonPlus (DE3)-RIL competent cells (Agilent). Cells were grown in Terrific Broth media to an optical density of 1.0 (600 nm) ...
-
bioRxiv - Biophysics 2021Quote: ... proteins were expressed using BL21(DE3) cells (Agilent). The cells were grown at 37°C until an optical density at 600nm of .6 then induced with 0.2mM isopropyl-Beta-D-thiogalactoside overnight at 18° C ...