Labshake search
Citations for Agilent :
2301 - 2350 of 7696 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: E.coli expression plasmids encoding GST-PEX14-NTD with amino acid substitutions were constructed via Site Directed Mutagenesis using QuikChange II (Stratagene). ß-tubulin (amino acids 388–444 ...
-
bioRxiv - Bioengineering 2021Quote: ... All PCR reactions for cloning and amplification of sequencing templates were performed using Herculase II Fusion DNA Polymerase (Agilent Technologies), and using GoTaq (Promega ...
-
bioRxiv - Bioengineering 2020Quote: The physico-chemical properties of fusion RBM-HFtn were analyzed by SEC-HPLC (Agilent 1260 Infinity II HPLC system, column Agilent AdvancedBio SEC 300Å 2.7 μm 7.8 × 300mm ...
-
1H NMR chemical exchange techniques reveal local and global effects of oxidized cytosine derivativesbioRxiv - Biophysics 2021Quote: ... 50 Purification of the oligonucleotides was achieved with a HPLC system (Agilent 1260 Infinity II 400 bar pump and a Agilent 1260 Infinity II VWD detecting at 260 nm ...
-
bioRxiv - Cancer Biology 2021Quote: ... - Kinetex EVO (5 μm, 100 Å)) using an HPLC system (Agilent, LC 1260 Infinity II, Agilent, Santa Clara, CA, USA). A two-step gradient was applied ...
-
bioRxiv - Cell Biology 2021Quote: PCR amplification of inserted sgRNAs from the genomic DNA was done with the Herculase II Fusion DNA Polymerase (Agilent Technologies) using the primers oMCB-1562 and oMCB-1563 ...
-
bioRxiv - Cell Biology 2021Quote: The CC and ORD domains of ORP5 or the TM domain of ORP8 were deleted using site-directed mutagenesis (Quickchange II-XL, Stratagene) to generate EGFP-ORP5ΔCC and EGFP-ORP5ΔORD or EGFP-ORP8ΔTM.
-
bioRxiv - Microbiology 2020Quote: ... was generated by introducing mutations in the 3’ splice site of the pPOLI-WSN-M plasmid using QuikChange II site-directed mutagenesis protocol (Agilent). pPolI-WSN-M-M2SMRtoAAA (Mut1) ...
-
bioRxiv - Genomics 2021Quote: ... 4 μl of the purified product were amplified in multiple 100 μl reactions using Herculase II Fusion DNA Polymerase (Agilent) following the manufacturer’s specifications with 0.3 μM of the IS5/IS6 primers ...
-
bioRxiv - Microbiology 2021Quote: ... Site-directed mutagenesis was performed on plasmids expressing CV3-25 antibody heavy chain in order to introduce the GASDALIE mutations (G236A/S239D/A330L/I332E) using the QuickChange II XL site-directed mutagenesis protocol (Stratagene) (Ullah et al. ...
-
bioRxiv - Immunology 2020Quote: ... The S228P amino acid change in the anti-MuSK antibodies was achieved by converting AGC>CCC through side-directed mutagenesis based on the QuikChange II system (Agilent). To make the b12 antibody suitable as an exchange partner for cFAE ...
-
bioRxiv - Systems Biology 2020Quote: ... 3.5 μl/well was then used as template for 2nd PCR in a 50 μl reaction together with 0.5 μl Herculase II fusion DNA polymerase (Agilent Technologies), 10 μl 5* Herculase II reaction buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... a 6.0 kb XbaI fragment obtained by screening a BTx623-derived BAC library with a ZmRA1 probe was cloned into pBluescript II KS (Agilent) and the HindIII site in the polylinker was used for ligation into pSB11_BAR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mutations were introduced in pENTR-SKOR1 following the QuikChange II XL Site-Directed Mutagenesis protocol (QuikChange; Agilent Technologies, Wilmington DE). Three silent mutations were introduced to create resistance to sh901 (SKOR1-shRes ...
-
bioRxiv - Cancer Biology 2022Quote: ... while the size and purity of the libraries were examined on a Bioanalyzer DNA 1000 series II chip (Agilent Technologies). The flow chart of the sequential steps involved in the TruSeq library preparation is given in Figure S2 ...
-
bioRxiv - Plant Biology 2021Quote: ... analyses were performed with a model QTRAP 6500 (ABSciex) mass spectrometer coupled to a liquid chromatography system (1290 Infinity II, Agilent). Analyses were performed in the positive mode ...
-
bioRxiv - Microbiology 2020Quote: ... The first reaction resulted in a plasmid containing 2,000 bp-long homologous arms (amplified from the genomic DNA of V. dahliae isolate Ls.17 using the Herculase II Fusion DNA polymerase; Agilent) flanking the neo cassette (conferring resistance to geneticin ...
-
bioRxiv - Bioengineering 2020Quote: ... The post-lyophilization and reconstitution SEC was performed using an Agilent HPLC 1260 Infinity II LC System using an AdvanceBio SEC column (300 Å, 2.7 μm, Agilent). Fluorescence (excitation 285 nm ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA sequence libraries were prepared from genomic DNA by two rounds of PCR using the Herculase II Fusion DNA Polymerase (Agilent). sgRNA sequences were amplified by the primers oMCB1562 and oMCB1563 and then indexed using the Illumina TruSeq LT adaptor sequences (AD002 ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Biophysics 2019Quote: ... anti-surfactant C protein antibody to target membrane antigen secreted from airway type 2 epithelial cells in alveoli or ii) anti-thyroid transcription factor-1 (TTF-1) antibody (Dako Agilent Products ...
-
bioRxiv - Molecular Biology 2020Quote: Mutant GFP library was made in arabinose inducible pBAD vector using a random mutagenesis approach by error-prone polymerase Mutazyme II (Agilent) that incorporated 7 to 11 mutations per kb of the template ...
-
bioRxiv - Cell Biology 2019Quote: ... Point mutants (E76K, C459E, and DM) were generated from the parental SHP2-migR1 construct using site-directed mutagenesis (QuikChange II, Agilent). SH2-only and phosphatase-only mutants were generated by cloning the PTP (220-525 aa ...
-
bioRxiv - Developmental Biology 2019Quote: ... Candidate Onecut1 cis-regulatory elements were amplified from chick or mouse genomic DNA with Herculase II polymerase (Agilent, 600677-51), treated for 10-30 minutes with Taq polymerase (Qiagen ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Immunology 2021Quote: Mouse plasma samples were analyzed by SEC–high-performance liquid chromatography (SEC-HPLC) using an Agilent 1260 II HPLC attached to a quaternary pump and a photodiode array detector (DAD) (Agilent). Plasma samples and hemoglobin standards were separated on a Diol-300 (3 µm ...
-
bioRxiv - Cell Biology 2020Quote: ... The S135A mutant form of NS3 was generated using site-directed mutagenesis to create pCMV-Myc-NS3-S135A Brazilian ZIKV (QuikChange II, Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... 300 mM NaCl (for samples without nucleosomes) or 150 mM NaCl (for samples with nucleosomes) attached to an 1260 Infinity II LC System (Agilent). MALS was carried out using a Wy-att DAWN detector attached in line with the size exclusion column.
-
bioRxiv - Developmental Biology 2021Quote: Antisense probes for in situ hybridization were synthesized as previously described (Pearson et al., 2009) from DNA templates amplified from pBS II SK(+) (Stratagene) or pPR-T4P (Liu et al. ...
-
bioRxiv - Biochemistry 2021Quote: SEC analysis was performed using an Agilent HPLC 1260 Infinity II LC System using an AdvanceBio SEC column (300 Å, 2.7 μm, Agilent). Each analyte was injected at 1-10 μM and run with a constant mobile phase of 0.15 M sodium phosphate for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... All nMagHigh1 and pMagFast2 mutants tested in our screening were generated by site-directed mutagenesis (QuikChange II XL, Agilent technologies) following manufacturer instruction ...
-
bioRxiv - Microbiology 2021Quote: ... Site-specific mutants in ftsA were constructed by site-directed mutagenesis of ftsA expression plasmids using the QuikChange II XL mutagenesis system (Agilent) and confirmed by sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... two mutations (R508S/R511S) were introduced in the furin cleavage site (508REKR511) using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing.
-
bioRxiv - Microbiology 2021Quote: ... three independent PCR reactions were carried out in a final volume of 50 µl with Herculase II fusion DNA polymerase (Agilent), then pooled and confirmed on gel electrophoresis for both fungi and bacteria ...
-
bioRxiv - Cell Biology 2021Quote: ... The jordan and shaker-2 non-synonymous substitutions were separately introduced into pFastbac1 M15-2IQ-EGFP-FLAG by site-directed mutagenesis (QuikChange II, Agilent) and verified by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Immunology 2022Quote: ... 60ng of DNA was used for PCR mix reaction prepared according to the manufacturer protocol (Herculase II Fusion DNA Polymerase, Agilent). The following Cre primers were used to carry out the PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: Peptide samples were run on a Thermo Scientific Orbitrap Lumos mass spectrometer coupled to an EASY-nLC II 1200 chromatography system (Agilent). Samples were loaded onto a 50 cm fused silica emitter (packed in-house with ReproSIL-Pur C18-AQ ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Three biological replicates were analysed qualitatively and quantitatively by 1290 Infinity II series UHPLC system (Agilent Technologies, Santa Clara, CA) equipped with Zorbax Eclipse Plus C18 column maintained at 30 °C ...
-
bioRxiv - Physiology 2022Quote: ... This construct has an artifactual amino acid change in its coding sequence (I143V) and site-directed mutagenesis (Quikchange II XL, Agilent) was performed to convert it back to WT with following two primers (all primers were ordered from Integrated DNA Technologies):
-
bioRxiv - Cell Biology 2022Quote: ... Guide sequence libraries were prepared from genomic DNA by two rounds of PCR using the Herculase II Fusion DNA Polymerase (Agilent). First ...
-
bioRxiv - Cell Biology 2022Quote: ... The wild type form of RNAi-resistant MUS81 ORF cloned into the pEF1a-IRES-NEO plasmid was subjected to SDM (Quickchange II XL – Stratagene) to introduce the T86 or S97 mutations ...
-
bioRxiv - Immunology 2023Quote: ... Double-stranded DNA was amplified from cDNA with CMVR-SOSIP-fwd (gtcaccgtcgtcgacgccacc atggaaaccgatacactgct) and CMVR-SOSIP-rev using Herculase II Fusion DNA Polymerases (Agilent) and subcloned into CMVR vector by SalI/BglII digestion and ligation ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of the genomic DNA was adjusted to 200 ng/µL before it was PCR amplified using Herculase II (Agilent). Approximately 400 ng purified PCR product (PCR purification kit ...
-
bioRxiv - Microbiology 2024Quote: ... Primers containing the desired deletions and complement were used to amplify the entire plasmid sequence using PfuUltra II fusion HS DNA polymerase (Agilent). After PCR ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were loaded on a Superose 6 Increase column (Cytiva) run by a 1260 Infinity II HPLC (Agilent Technologies) at 0.6 mL/min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The P12 beamline was equipped with an Agilent 1260 Infinity II Bio-inert liquid chromatography system (LC Agilent, Waldbronn, Germany). The data were recorded as a sequential set of 2880 individual 1 s frames corresponding to one column volume for each protein sample (48 min total) ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was carried out using 10-fold diluted cDNA and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828) with the appropriate primer pairs (listed in Supplementary Table 3 ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed in a 25 μL reaction volume consisting of 12.5 μL Brilliant II SYBR Green Master Mix (Agilent Technologies), 1.0 μL of 10 μM forward DSR-1F (5’-ACS CAC TGG AAG CAC GGC GG −3’ ...