Labshake search
Citations for Agilent :
2251 - 2300 of 4302 citations for 1 6 ANHYDRO β D GLUCOSE 2 3 4 TRI O ACETATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
HNF4α isoforms regulate the circadian balance between carbohydrate and lipid metabolism in the liverbioRxiv - Genomics 2021Quote: ... Liver NE from WT and α7HMZ mice were prepared as previously described (Yuan et al., 2009).A custom-designed array was ordered from Agilent (SurePrint G3 Custom GE 4×180k), which contained oligonucleotides ∼60 nucleotides (nt ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Biochemistry 2024Quote: ... ab109401 (1:5000)) or and anti-total Tau antibody (rabbit anti-human Tau, Dako, #A0024 (1:5,000)) diluted in 3% BSA in PBS-T overnight at 4°C shaking ...
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:10 and 1:50 dilutions of the library on a Bioanalyzer High sensitivity DNA Chip (Agilent) and running it on Bioanalyzer 2100AB (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...
-
bioRxiv - Immunology 2021Quote: ... Paraffin sections (4µm thick) of FFPE thymus and lymph node tissues (NMR, mouse, and human control) were stained for cytokeratin (AE1/AE3, Dako GA05361-2) on a Dako Omnis autostainer with pressure cooker antigen retrieval (TrisEDTA ...
-
bioRxiv - Microbiology 2021Quote: ... were acidified with 5 µl of 30% HCl per 2 mL to prevent precipitation and measured by inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent Technologies 5100). Porewater for dissolved inorganic carbon (DIC ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2021Quote: ... Entry clones for other mutant dynamin 2 were prepared by introducing corresponding mutations into the Entry clone of wild type human dynamin 2 using QuikChange Lightning Site-directed Mutagenesis kit (Agilent Technologies, 210518) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Microbiology 2022Quote: ... Sialyl-Lewis a (sLea) and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... Sizes and yields of RACE products (2 µL aliquots) were determined using a Fragment Analyzer (Advanced Analytics; now Agilent, Santa Clara USA) equipped with 55 cm electrophoresis capillaries and reagents capable of resolving dsDNA fragments between 35 and 1500 bp (see Fig 1E) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were washed with TBST and slides were developed by adding AEC+ High Sensitivity Substrate Chromogen Ready to use (Dako K346111-2).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... three washes with phosphate buffered saline (PBS) and the incubation with the primary antibody in the DAKO Real TM antibody diluent (Agilent #S202230-2) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Genomics 2019Quote: ... Gene expression was performed on 7900 HT fast real time PCR system (Applied Biosystem, USA) using 2× Brilliant III SYBR@ Green qPCR Master Mix (Agilent Technologies, USA) and gene specific primers (Supplementary Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... After 10 minutes of formalin fixation of the tissue on the slides they were dried with isopropanol and stained with Mayer’s hematoxylin (Dako, cat.no.: S330930-2) and bluing buffer (Dako ...
-
bioRxiv - Microbiology 2022Quote: ... the plates were incubated with serially diluted serum samples for 2 h at room temperature and antibody binding detected using horseradish peroxidase–labelled rabbit anti-guinea pig antibody (Dako, Glostrup, Denmark) and 5,5’-dithiobis-(2-nitrobenzoic acid) ...
-
bioRxiv - Neuroscience 2022Quote: ... The sections were rinsed in PBS (2 × 10 min) before antigen-retrieval by incubation in target retrieval solution (Dako S1700, Glostrup, Denmark) for 40 min at 85 °C ...
-
bioRxiv - Immunology 2023Quote: ... following standard protocol and plated at a concentration of 2×105 cells per well of a seahorse XFe96 assay plate in seahorse XF DMEM media (Agilent; 103575-100) supplemented with 1mM pyruvate ...
-
bioRxiv - Cancer Biology 2023Quote: FISH assay was performed on tissue microarrays using the Histology FISH accessory kit (K579911-2, Dako, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Amino acid substitutions or deletions were introduced into the pSARS-CoV-2-SΔ19 expression vector by site-directed mutagenesis (Stratagene, La Jolla, CA) by following the manufacturer’s instructions and using mutagenic oligonucleotides SaCoV2-K417T-F ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 200 μL of supernatant was pipetted into a nylon syringeless filter (Whatman, UN203NPENYL) and transferred to a 2 mL chromatography vial (Agilent, 5181-3376) with a glass vial insert (5183-2085 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biophysics 2022Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (33) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A 2 µl aliquot of processed gDNA was taken to assess shearing using an Agilent High Sensitivity D1000 Kit (Agilent, Cat. #G2991AA). Once shearing was assessed ...
-
bioRxiv - Microbiology 2023Quote: ... 200 mm by 2 mm fitted with a precolumn 10 mm by 2 mm (Dr. Maisch GmbH, Ammerbuch, Germany) coupled to an Agilent LC/MSD Ultra Trap System XCT 6330 (Agilent, Waldbronn, Germany). For analysis were used ...
-
bioRxiv - Cell Biology 2024Quote: qPCR was performed using 2× SYBR Green qPCR Mix (Low ROX) (Aidlab Biotechnologies, Beijing, Chian) in a Stratagene Mx3000P (Agilent Technologies, SUA). With GAPDH mRNA as endogenous control ...
-
bioRxiv - Biophysics 2019Quote: ... Mutants of K2P2.1 (TREK-1) and K2P2.1(TREK-1)CRYST were generated using site-directed mutagenesis (PFU Turbo AD, Agilent) and verified by sequencing of the complete gene.
-
bioRxiv - Cell Biology 2021Quote: ... The pST39-BLOC-1 plasmid encoding recombinant BLOC-1 was transformed into BL21gold(DE3)plysS cells (230134, Agilent). Several colonies from the plate were inoculated into a starter culture of 10 ml LB supplemented with 34 μg/ml chloramphenicol and 100 μg/ml ampicillin that was grown overnight at 37 °C with moderate shaking ...