Labshake search
Citations for Agilent :
2251 - 2300 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Microarray data interpretation: The images obtained from the G265BA microarray scanner (Agilent Technologies®) were analysed with Pro Scan Array Express software (PerkinElmer® ...
-
bioRxiv - Bioengineering 2024Quote: Exoglycosidases were procured from Prozyme (San Leandro, CA) or New England Biolabs (AMF ...
-
bioRxiv - Bioengineering 2024Quote: ... The final libraries were quantitated on Qubit and the average size determined on the AATI Fragment Analyzer (Agilent Technologies, Santa Clara, CA) and diluted to 5nM final concentration ...
-
bioRxiv - Bioengineering 2024Quote: 1 mg of streptavidin (Agilent) was dissolved in 370 µL of deionized (DI ...
-
bioRxiv - Biochemistry 2024Quote: ... equipped with Peltier temperature control (Agilent Technologies, model 89090A). The sample concentration was determined based on the absorbance maximum of the FMN cofactor around 450 nm using a molar extinction coefficient of 12,500 M-1 cm-1 ...
-
bioRxiv - Biochemistry 2024Quote: ... AsLOV2 variants were generated by site-directed mutagenesis according to the QuikChange protocol (Agilent Technologies). For expression of N ...
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Bioengineering 2024Quote: ... and SPE cleanup was performed using GlycoClean S-Cartridges (Prozyme, Hayward, CA). After cleanup ...
-
bioRxiv - Bioengineering 2024Quote: ... The size of purified DNA was profiled with the genomic DNA ScreenTape assay (range: 200∼60000 bp) via the 4200 TapeStation system (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... any unbound GTP was washed out and the bound GTP levels were measured on Biotek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Bioengineering 2024Quote: ... RNA integrity (RIN) was evaluated using the 4200 TapeStation System (Agilent; Santa Clara, CA); all RIN values were greater than 8 ...
-
bioRxiv - Biochemistry 2024Quote: ... the GEF protein was added and the absorbance was recorded for an additional on Biotek Synergy HT or Biotek Synergy H1 (Agilent, Winooski, VT). DMSO was employed as vehicle control ...
-
bioRxiv - Biochemistry 2024Quote: ... The unhydrolyzed GTP that was converted to ATP was recorded on BioTek Synergy HT (Agilent, Winooski, VT).
-
bioRxiv - Bioengineering 2024Quote: ... and RNA integrity numbers (RINs) were determined using a TapeStation (Agilent) (average RIN of 7.5) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Biochemistry 2024Quote: Spectra of dark-adapted AsLOV2 and NcVVD variants were acquired at 22°C on a diode-array absorbance spectrophotometer (Agilent Technologies, model 8453) equipped with Peltier temperature control (Agilent Technologies ...
-
bioRxiv - Immunology 2024Quote: ... RNA quantity and purity analysis was done using Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA) with RIN number >7.0 ...
-
bioRxiv - Immunology 2024Quote: ... The size distribution of the libraries was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, #5067-4626), and the DNA concentration was quantified using a Qubit dsDNA HS Assay Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2024Quote: A genetic library was constructed based on the metX and metY genes with the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA, USA), adjusted to produce an average of 4 nonsynonymous mutations per gene ...
-
bioRxiv - Biochemistry 2024Quote: ... 300 µL of each reaction mixture were placed in a quartz cuvette and monitored at 550 nm using a Cary60 spectrophotometer (Agilent technologies). After 10 seconds ...
-
bioRxiv - Biochemistry 2024Quote: ... using the QuikChange Site-Directed Mutagenesis kit (Agilent Technologies) and mutagenic primers listed in Supplementary Table 3.
-
bioRxiv - Biochemistry 2024Quote: ... Analysis of the sample solutions was performed on an Agilent 5975C Mass Spectrometer (Agilent Technologies, CA, USA) using a Zebron ZB-5HT Inferno GC column (30 m x 0.25 mm i.d. ...
-
bioRxiv - Biochemistry 2024Quote: ... Total iron and copper concentrations were assessed by a tandem quadrupole 8800 ICP-QQQ system (Agilent Technologies, Santa Clara, CA, USA) using mixed hydrogen and helium as reaction cell gases ...
-
bioRxiv - Biochemistry 2024Quote: ... Cleavage was validated by SDS-PAGE and size exclusion chromatography on a Agilent 1260 Infinity II system using an Agilent AdvanceBio SEC 300 Å 2.7 μm 4.6x300 mm column (Agilent Technologies, PL1580-5301) using the manufacturer’s recommended conditions ...
-
bioRxiv - Biochemistry 2024Quote: 150-250 µg fragments of LDPE film discs were placed in deactivated stainless-steel sample cups and introduced into a multi-shot EGA/PY-3030D pyrolyzer (Frontier Laboratories, Fukushima Japan) coupled to a 7890N gas chromatograph and a 5975 mass selective detector (Agilent Technologies, Santa Clara, CA, USA). The furnace temperature was set to 550 °C and the temperature of the interface between the furnace and the GC/MS system was set to 200 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... and the molar mass distribution in PVC materials were determined using a 1260 HPLC system equipped with three PLgel 5 µm Mixed-C columns and a PLgel guard column (Agilent Technologies, Santa Clara, CA, USA). Approximately 5 mg of PVC was dissolved in 1 mL of tetrahydrofuran at room temperature for at least 14 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 were collected with a 5500 Series spectrometer equipped with a diamond-ATR (attenuated total reflectance) sampling module (Agilent Technologies, Santa Clara, CA, USA). The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise ...
-
bioRxiv - Biochemistry 2024Quote: ... The signals were obtained with 8 cm-1 spectral resolution (unless specified otherwise) by performing 35 consecutive readings per measurement in 4,000-650 cm-1 range using MicroLab PC software (Agilent Technologies) and further processed with Spectragryph (F ...
-
bioRxiv - Biochemistry 2024Quote: ... Polystyrene standards with a narrow molecular mass distribution and Mpeak in the range of 1,140 – 7,500,000 g/mol (Agilent Technologies, Santa Clara, CA, USA) were used for calibration.
-
bioRxiv - Biochemistry 2024Quote: ... were determined using a GPC-IR5 system (Polymer Char, Valencia, Spain) equipped with four PLgel 20 µm MIXED-A columns (Agilent Technologies, Santa Clara, CA, USA). Approximately 4 mg of LDPE film was pre-dissolved in 8 mL of 1,2,4-trichlorobenzene at 160 °C for 3 hours and 200 µL samples were injected into the SEC system ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were injected into analysis by an Agilent 6850 Gas Chromatograph system coupled to a 5975 series MSD (Agilent Technologies, Santa Clara, CA, USA) equipped with a Sapiens-5MS (30 m × 0.25 µm × 0.25 µm ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-SUMO-ZF5.3 was transformed into Escherichia coli BL21DE3 Gold (Agilent) and selected on a kanamycin Luria Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: All tryptophan fluorescence assays were performed using a Cary Eclipse fluorimeter (Agilent). Fluorescence emission spectra were collected using 0.5 µM VC0430 in 50 mM Tris ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Biochemistry 2024Quote: ... CaM-linked agarose beads (Agilent) were equilibrated in the same buffer before adding the FBA preparations and incubating for 5 min at room temp ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The libraries were further accessed for quality using a 5300 Fragment Analyser (Agilent; California, USA), followed by a 50 bp single-end sequencing across four lanes of NovaSeq 6000 (Illumina ...
-
bioRxiv - Biochemistry 2024Quote: All point mutations were generated using QuikChange II following the manufacturer’s instructions (Agilent, 200523).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was performed using a pressure cooker (Dako, Agilent Technologies). Primary antibodies were incubated overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA). RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep for Illumina using manufacturer’s instructions (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified by using Qubit 2.0 Fluorometer (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... All subsequent steps were performed through an Agilent Bravo liquid handling robot (Agilent Technologies, USA). 5mM TCEP and 20mM CAA were added and incubated for 30 minutes in the dark to ensure reduction and alkylation of proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... samples were depleted semi-automatically with an Agilent Multiple Affinity Removal Column Human 14 column (MARS Cat# 5188-6557, Agilent Technologies, USA) on a microflow HPLC system using MARS buffers A and B in a gradient as suggested by the manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nanodrop quantified RNA was checked by Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies). Samples with RNA integrity number > 10 were used for library preparation (Illumina Stranded mRNA Prep kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... washed with PBS and analyzed with NovoCyte Flow Cytometer (Agilent). Median fluorescence intensities (MFI ...
-
bioRxiv - Cancer Biology 2024Quote: ... fragments using Herculase II Fusion DNA Polymerase (Agilent Technologies; cat. 600677) and primers with 30 cycles and annealing at 63°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... The AR DBD domain DNA fragment was amplified using Herculase II Fusion DNA Polymerase (Agilent Technologies; cat. 600677) with 36 cycles and annealing at 63.5°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and size using DNA High Sensitivity Bioanalyzer chips (Agilent; cat. 5067-4626), and those passing quality control (with an equal size distribution between 250-400 bp ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA quality was checked using a BioAnalyser Nano 6000 Chip (Agilent). Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then incubated for 3 h before being analyzed with NovoCyte Flow Cytometer (Agilent). For the other markers ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Metabolites from the TCA cycle and glycolysis were detected using the 1260 Infinity LC System (Agilent) coupled to the QTRAP6500+ (ABSciex ...