Labshake search
Citations for Agilent :
2101 - 2150 of 8176 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 1 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and PCNA (DAKO, MO879, 1:500). A polyclonal antibody to Drosophila tau was prepared in rabbits immunized with full length recombinant tau protein (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... mouse anti-HIV-1 P24 (Dako), goat anti-human TRAIL (RyD Systems ...
-
bioRxiv - Neuroscience 2024Quote: ... antiGFAP (rabbit, 1:500, Dako, USA), antiOCT4 (rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100 (DAKO; 1:600), mouse anti-Myelin Basic Protein (Covance SMI 94 ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP (Dako, Denmark; 1:500) proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Myogenin (diluted 1/100, DAKO), anti-MYH3 (diluted 1/100 ...
-
bioRxiv - Physiology 2023Quote: ... anti-CD45 (Dako M0701; 1:100) or anti-SLC2A1 (Abcam ab15309 ...
-
bioRxiv - Immunology 2024Quote: ... anti-IgD (1:2000; AA093; DAKO), anti-CD27 (1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Biochemistry 2024Quote: ... ab109401 (1:5000)) or and anti-total Tau antibody (rabbit anti-human Tau, Dako, #A0024 (1:5,000)) diluted in 3% BSA in PBS-T overnight at 4°C shaking ...
-
bioRxiv - Plant Biology 2020Quote: ... pAD-WT and pBD-WT from the HybriZAP 2.1 kit (Stratagene, USA) were used as a control of positive interaction (C+) ...
-
bioRxiv - Biophysics 2020Quote: ... using the QuikChange II site directed mutagenesis kit (Agilent, Santa Clara, CA) with primers purchased from Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... staining was revealed using the IDetect Super strain HRP polymer kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and sizing was determined by Fragment Analyzer HS Small Fragment Kit (Agilent). A smear analysis was conducted in the range of 150 to 1000 bp ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR mutagenesis was performed using QuickChange II site directed mutagenesis kit (Agilent) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Site-directed mutagenesis was performed using Quikchange Lightning mutagenesis kit (Agilent Technologies) and pEGFP-c1 hsOCRL1 (wild-type ...
-
bioRxiv - Cell Biology 2020Quote: ... and Agilent G1607A CE-ESI-MS sprayer kit (Agilent Technologies, Waldbronn, Germany). The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... we used the Low-Input QuickAmp kit (Agilent, Santa Clara, CA, USA). The resulting cRNA was purified using the Absolute RNA Nanoprep kit (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). Libraries were sequenced on a HiSeq 4000 (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries were prepared using the SureSelect XT Library Prep Kit (Agilent) following the manufacturer instructions ...
-
bioRxiv - Genetics 2021Quote: ... and fragment size was checked using the High Sensitivity DNA kit (Agilent). The libraries were sequenced on an Illumina MiSeq ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and analysis using the Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). High quality samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Developmental Biology 2020Quote: ... Chromogenic detection was implemented with EnVision Detection System-HRP (DAB) kit (Dako).
-
bioRxiv - Systems Biology 2022Quote: ... Sample quality and concentration were assessed by bioanalyzer (High Sensitivity kit, Agilent) and Qubit (Thermofisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCDH15 108N mutations were generated using the QuikChange Lightning mutagenesis kit (Agilent) and mutant protein fragments were expressed and purified identically to the wild-type constructs ...
-
bioRxiv - Genomics 2020Quote: ... with either a high sensitivity or normal D5000 ScreenTape assay kit (Agilent) or Fragment analyzer (AATI) ...
-
bioRxiv - Genomics 2020Quote: ... and quality controlled using a Bioanalyser High Sensitivity DNA Analysis kit (Agilent). Twelve liver ATAC-seq libraries arising from 3 biological replicates x 4 time points (T1-T4 ...
-
bioRxiv - Biochemistry 2020Quote: ... were constructed via the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent). Expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... samples were incubated with secondary HRP-conjugated antibody (from DAKO envision kit) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... Mutagenesis was performed using the QuikChange Lightning site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: Samples were analyzed by bioanalyzer using DNA-1000 kit (Agilent #5067-1504). Concentration of each library was determined by integrating under the peak of approximately 225-275bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the RNA 6000 Nano Kit (Agilent Technologies; cat. no. 5067-1511).
-
bioRxiv - Genomics 2019Quote: ... RNA profiles were then checked by Bioanalyzer (Agilent RNA 6000 Nano kit) and 1ug of RNA from each condition was used for mRNA-seq ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations were introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). A targeting cassette including ∼50 bp homology to the target region on either end was amplified by PCR ...
-
bioRxiv - Immunology 2019Quote: ... using the Seahorse XF Cell Mito Stress test kit (Agilent, 103015-100). 150.000 peritoneal macrophages and 25.000 primary hepatocytes were plated per well respectively ...
-
bioRxiv - Physiology 2019Quote: ... Quality of RNA was assessed using a RNA nano Bioanalyzer kit (Agilent) using a Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Bound primary antibody was detected with an immunoperoxidase kit (EnVision Plus; Dako). Negative controls without primary antibody were used for all samples to confirm specificity ...
-
bioRxiv - Cell Biology 2019Quote: ... while site directed mutagenesis was done using the QuickChange II kit (Agilent). Complex reconfigurations of vector backbones and all point mutations were subsequently verified using standard Sanger sequencing (Macrogen ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified with Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis was performed with the QuikChange site-directed mutagenesis kit II (Stratagene) and successful mutagenesis was confirmed by sequencing ...
-
bioRxiv - Genomics 2021Quote: ... using the RNA 6,000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2021Quote: ... For secondary antibody incubation and signal detection LSAB and AEC Kits (DakoCytomation) were used following the manufacturers protocol ...
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...
-
bioRxiv - Immunology 2021Quote: ... and quality checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode (2 x 75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... to generate pScGFPTUB1 using a Stratagene blunt PCR cloning kit (Agilent Technologies). The neomycin (NEO ...