Labshake search
Citations for Agilent :
2101 - 2150 of 8606 citations for Oxytocin ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Mutations were introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). A targeting cassette including ∼50 bp homology to the target region on either end was amplified by PCR ...
-
bioRxiv - Immunology 2019Quote: ... using the Seahorse XF Cell Mito Stress test kit (Agilent, 103015-100). 150.000 peritoneal macrophages and 25.000 primary hepatocytes were plated per well respectively ...
-
bioRxiv - Physiology 2019Quote: ... Quality of RNA was assessed using a RNA nano Bioanalyzer kit (Agilent) using a Bioanalyzer 2100 (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Bound primary antibody was detected with an immunoperoxidase kit (EnVision Plus; Dako). Negative controls without primary antibody were used for all samples to confirm specificity ...
-
bioRxiv - Cell Biology 2019Quote: ... while site directed mutagenesis was done using the QuickChange II kit (Agilent). Complex reconfigurations of vector backbones and all point mutations were subsequently verified using standard Sanger sequencing (Macrogen ...
-
bioRxiv - Genomics 2019Quote: ... DNA was quantified with Qubit DNA HS assay kit and Bioanalyzer (Agilent) using the DNA High Sensitivity kit ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis was performed with the QuikChange site-directed mutagenesis kit II (Stratagene) and successful mutagenesis was confirmed by sequencing ...
-
bioRxiv - Genomics 2021Quote: ... using the RNA 6,000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2021Quote: ... For secondary antibody incubation and signal detection LSAB and AEC Kits (DakoCytomation) were used following the manufacturers protocol ...
-
bioRxiv - Biophysics 2020Quote: ... This mutation was introduced using Quick-change site-directed mutagenesis kit (Stratagene) following the manufacturer’s protocols37 The forward primer had the sequence CCAGTGAACGTGAGCTGCAACATTTTCATCAAC (the codon for Cys is underlined) ...
-
bioRxiv - Immunology 2021Quote: ... and quality checked using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode (2 x 75 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... an XF Cell Mito Stress Test kit (Seahorse Bioscience; Agilent Technologies, Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... to generate pScGFPTUB1 using a Stratagene blunt PCR cloning kit (Agilent Technologies). The neomycin (NEO ...
-
bioRxiv - Microbiology 2020Quote: RNA was isolated from purified gametocytes using an RNA purification kit (Stratagene). cDNA was synthesised using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... underwent antigen retrieval and were incubated with primary antibodies (KIT, DakoCytomation/Agilent; Ki-67 ...
-
bioRxiv - Biophysics 2020Quote: ... Polymerization interface mutants were generated using a QuikChange Lightning mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... METTL5 mutants were generated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Library quantification was performed with an Agilent DNA 1000 Kit (Agilent, CA). Template preparation with the DNA library followed by Ion Spheres Particle (ISP ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutants were generated with Quikchange XL kit (Agilent Technologies, Santa Clara, CA) and verified by sequencing.
-
bioRxiv - Neuroscience 2021Quote: ... Overnight IP’s were eluted and purified using Absolutely RNA Nanoprep kit (Agilent). RNA quality was assessed using Nanodrop spectrophotometer and Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP and Secretagogin was performed using the EnVision™ FLEX+ kit (Dako) as detection system and diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by site-directed mutagenesis using the QuickChange II Kit (Stratagene), and verified by sequencing.
-
bioRxiv - Biophysics 2021Quote: ... Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Wilmington, DE), we generated the phosphomimetic Y18E of this tau construct ...
-
bioRxiv - Cancer Biology 2021Quote: ... library size was evaluated using the Bioanalyser High Sensitivity DNA kit (Agilent). Libraries from the same experiment were diluted to 5nM ...
-
bioRxiv - Cell Biology 2021Quote: ... using The Cell Mito Stress Test Kit (Agilent, cat. no. 103015-100). MSCs were seeded at a density of 10,000 cells/well in a XF96 cell culture 96-well microplate (Agilent 101085-004 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... Each mutation was introduced using QuikChange II site-directed mutagenesis kit (Stratagene). All constructs were Sanger sequenced for verification ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were analysed using the Seahorse XF Glycolytic Rate Assay Kit (Agilent) with of 0.5 µM rotenone/antimycin A (Rot/AA ...
-
bioRxiv - Physiology 2020Quote: ... and quality checked using a Bioanalyzer High Sensitivity DNA Analysis kit (Agilent); concentration was measured through a qPCR-based method (KAPA Library Quantification Kit for Illumina Sequencing Platforms) ...
-
bioRxiv - Biochemistry 2020Quote: ... equipped with a commercial CE-MS adapter and sprayer kit from Agilent. Prior to use ...
-
bioRxiv - Microbiology 2020Quote: ... RNA profiles were assessed using the Bioanalyzer RNA 6000 Nano kit (Agilent). Ten micrograms of total RNA were converted into cDNA using the SuperScript II cDNA Conversion Kit (Invitrogen) ...
-
bioRxiv - Plant Biology 2021Quote: ... An RNA Nano 6000 Assay Kit and Bioanalyser 2100 system (Agilent Technologies) were used to assess RNA integrity for RNA-seq analyses ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Microbiology 2020Quote: ... This mutation was created with the Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Mutagenesis was performed by PCR using the Quikchange mutagenesis kit (Agilent Technologies) and primers specified in Table S2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and OCR determined using the Seahorse XF Cell Mito Stress Kit (Agilent). Basal respiration was measured in unstimulated cells ...
-
bioRxiv - Cell Biology 2021Quote: ... All stainings were visualized with Horseradish-peroxidase kit (DCS Innovative, Dako, K3468) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and an Agilent RNA 6000 Nano Kit (Agilent Technologies, Loveland, CO, USA). The library was prepared using a TruSeq 3000/4000 SBS Kit ...
-
bioRxiv - Biophysics 2021Quote: Site-directed mutagenesis was executed using the QuikChange Lightning kit from Agilent. HdeA-C18S-C66S was expressed and purified as outlined previously for wild type HdeA [11 ...
-
bioRxiv - Biophysics 2020Quote: ... All mutants were made using the QuikChange Site-Directed Mutagenesis Kit (Agilent) and validated by complete sequencing of the genes encoding for the proteins of interest.
-
bioRxiv - Biophysics 2020Quote: ... Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology). Soluble Sema4D was obtained from R&D Systems Reagents (see Collapse Assay paragraph below).
-
bioRxiv - Biophysics 2021Quote: ... Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA) was used for all mutagenesis ...
-
bioRxiv - Biophysics 2020Quote: ... Single point mutations were generated using QuikChange site-directed mutagenesis kit (Agilent) and majorities of them have been reported in previous publications ...
-
bioRxiv - Cell Biology 2021Quote: ... and quality evaluated using 2100 Bioanalyzer-RNA 3000 Pico Kit (Agilent Technologies), excluding those samples with RIN<5.0 ...
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated from purified gametocytes using an RNA purification kit (Stratagene). cDNA was synthesized using an RNA-to-cDNA kit (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... library size was determined using the BioAnalyzer High Sensitivity DNA Kit (Agilent). Sequencing was performed using an Illumina NextSeq500 ...
-
bioRxiv - Genetics 2022Quote: PCR products were cloned using StrataClone PCR Cloning Kit (Agilent, Waldbronn, Germany). Positive white colonies were randomly picked and verified with colony PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA High Sensitivity Assay kit on Bioanalyser 2100 (Agilent Technologies, CA, USA) was used for the library quantification and qualification and performed to calculate the mean size of the libraries were 375 base pairs ...