Labshake search
Citations for Agilent :
2051 - 2100 of 5728 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... vector containing the SARS-CoV-2 HA-ORF3a gene was used in site-directed mutagenesis using a QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Microbiology 2023Quote: ... were prepared and stained with hematoxylin eosin (HE) for histological examination or subjected to immunohistological staining to detect SARS-CoV-2 antigen (performed in an autostainer; Agilent), using the horseradish peroxidase (HRP ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Genomics 2024Quote: ... The high-molecular weight DNA sample was then sheared to a mean size of 20 kb with a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and the subsequent size distribution was assessed with an Agilent Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Plant Biology 2024Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Bioengineering 2024Quote: ... The final co-cultures were then incubated at 37°C in an automated spectrophotometer (Biotek Synergy 2, Agilent Technologies, USA) for 48 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Infection curve analysis was conducted by combining 107 CFU/ml of the clinical isolate selected and 108 PFU/ml of the phage selected in 200 µl of LB broth in a 96 well microplate and incubating for 24 h at 37°C in an Biotek Epoch 2 (Agilent). Productive infection was assumed to have taken place when the OD was significantly lower than the control in the exponential phase.
-
bioRxiv - Microbiology 2024Quote: ... tissues were incubated with primary antibodies overnight (Iba1 (019-19741, FUJIFILM Wako Pure Chemical Corporation) or S100b (GA50461-2, Agilent)) ...
-
bioRxiv - Molecular Biology 2020Quote: 3.0×103 cells per well were seeded in Xfp cell culture microplate (Agilent Technologies, Santa Clara, CA, USA) and incubated overnight while XF calibrant solution was added in each well of extracellular flux cartridge and incubated overnight without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells (3 · 104 hPASMC per well) were seeded onto XF96 V3 PS Cell Culture Microplates (101085-004, Agilent) and exposed to air or CSE for 24 hours before being loaded into the analyzer ...
-
bioRxiv - Developmental Biology 2019Quote: BeWO cells (10,000/well) were plated into Seahorse XF96 Cell Culture Microplates (Agilent Biotechnology, Cat No. 103275-100). The oxygen consumption rate (OCR) ...
-
bioRxiv - Physiology 2019Quote: ... cells were seeded in a density of 200 000 cells per well in XF-96 plates (Agilent Technologies), treated appropriately and kept in a 37°C/5% CO2 incubator ...
-
bioRxiv - Molecular Biology 2019Quote: ... in MDA-MB-231 cells were assessed by Agilent Seahorse XF Cell Mito Stress Test Kit and Agilent Seahorse XF Cell Energy Phenotype Test Kit (Agilent Technologies) and run in Agilent Seahorse XFe96 Analyzer (Seahorse Bioscience ...
-
bioRxiv - Biochemistry 2020Quote: HUVEC were seeded into Seahorse XF96 Cell Culture Microplates (3,000 cells/well; Agilent Technologies, Santa Clara, CA, USA), incubated for 24 h and then treated with glyoxal for 48 h ...
-
bioRxiv - Cancer Biology 2021Quote: 30,000 cells per well were plated in XF96 Cell Culture Microplates (Seahorse Bioscience, Agilent, Santa Clara, CA, USA) previously coated with Cell-Tak (BD Biosciences) ...
-
bioRxiv - Cancer Biology 2021Quote: 30,000 cells per well were plated in XF96 Cell Culture Microplates (Seahorse Bioscience, Agilent, Santa Clara, CA, USA) previously coated with Cell-Tak (BD Biosciences) ...
-
bioRxiv - Pathology 2022Quote: ... approximately 15,000 A549 cells were used to seed the wells of XF cell culture microplates (Seahorse Bioscience, US). On the analysis day ...
-
bioRxiv - Cancer Biology 2024Quote: Mitochondrial bioenergetics in AML cell lines were performed using the Seahorse XFp Cell Mito Stress Kit (Agilent Technologies) on the Seahorse XFe96 Analyzer ...
-
bioRxiv - Immunology 2024Quote: ... freshly prepared BMDM cells were reseeded in complete RPMI-1640 cells using Seahorse plates (Agilent cat. no. 103729100) at a density of 5 × 104 cells per well ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... HepG2 cells were seeded onto Poly-D-Lysine-coated (50 µg/ml) Seahorse XF96 cell culture plate (Agilent) at a density of 3.0 x 104 cells per well ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded at 4×104 cells per well in Seahorse XF24 tissue culture plates (Seahorse Bioscience Europe). The sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight ...
-
bioRxiv - Microbiology 2023Quote: Cells were seeded at 3,000 cells/well in 150 μL of complete media (above) in E-plates (Agilent) and grown overnight while being monitored with an xCELLigence SP system (Agilent) ...
-
bioRxiv - Cancer Biology 2023Quote: ... plated at a density of 30,000 cells/well in XF96 V3 PS cell culture microplates (Agilent, 101085-004) and incubated for ∼16 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... plated at a density of 35,000 cells/well in XF96 V3 PS cell culture microplates (Agilent, 101085-004) and incubated for ∼16 hr ...
-
bioRxiv - Bioengineering 2023Quote: ... we first seeded 2,000 cells in specialized Seahorse assay plates (Seahorse XF Cell Mito Stress Test Kit, Agilent) and incubated them for 24h at 33 °C for proliferation and for 7 days at 37 °C for maturation ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were seeded in regular growth medium (20% DMEM) into XF96 V3 PS Cell Culture Microplates (Agilent Technologies) then medium changed the following day ...
-
bioRxiv - Biophysics 2021Quote: ... coli BL21 (DE3) pLysS-competent cells (Stratagene) for protein expression and purification ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Star (DE3) cells (Agilent Technologies). Cells were grown in lysogeny broth (LB ...
-
bioRxiv - Cell Biology 2020Quote: ... treated Seahorse XF96 Cell Culture Microplates (Agilent) and XFe96 sensor cartridge (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in Seahorse Media (Agilent) supplemented with 10 mM glucose ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli BL21-CodonPlus (DE3)-RIL cells (Agilent). Cell cultures were grown to an OD600 of ∼0.5-0.7 and then cooled down to 16°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... coli XL1-Blue electroporation-competent cells (Agilent), which were then plated on 6 25-cm agar plates containing 2xTY medium broth and ampicillin ...
-
bioRxiv - Microbiology 2020Quote: ... coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21-CodonPlus(DE3)-RIL cells (Stratagene) and grown in LB media containing appropriate antibiotics ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21-CodonPlus(DE3)-RIL cells (Stratagene) and grown in LB media containing appropriate antibiotics ...
-
bioRxiv - Biophysics 2019Quote: ... coli cells (Agilent Technologies; Santa Clara, CA). Plasmid were isolated using an E.Z.N.A Plasmid MiniPrep Kit (Omega Bio-teck ...
-
bioRxiv - Molecular Biology 2019Quote: ... coli BL21-CodonPlus(DE3)-RIL cells (Stratagene) following overnight induction at an OD600nm of 0.8 with 0.5 mM isopropyl-β-D-thio-galactoside (IPTG ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were harvested using a Vpsin (Agilent) plate centrifuge for 8 minutes at 3000 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... coli BL21 (DE3) pLysS cells (Agilent Technologies). This construct encodes SKP2 residues 1-140 (SKP2N ...