Labshake search
Citations for Agilent :
2051 - 2100 of 4255 citations for 6H 1 2 Thiazine 6 ethoxy 5 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... for 2hrs at 40°C and then incubated over-night at 4°C on a rotating wheel with 2 μg of anti HBc antibody (Dako B0586). Immune-complexes were captured with protein A/G magnetic beads ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were further diluted with ultrapure water to a final concentration of 2% HNO3 and subjected to ICP-MS on Agilent 7700 ICP-MS (Agilent Technologies). ICP-MS runs were calibrated with high-purity iron standard solution (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 µL of purified PKD1KD at 2 mg/mL was injected onto an S200 10/300 column (Cytiva) connected to a 1260 Infinity HPLC (Agilent Technologies). A MiniDawn Treos (Wyatt ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 μl of 2 – 4 mg/ml protein samples were applied to a column using the 1260 Infinity HPLC system (Agilent Technologies) coupled to a MiniDawn Treos detector (Wyatt Technologies ...
-
bioRxiv - Immunology 2021Quote: ... embedded in paraffin, and automatically stained for SARS-CoV-2 (2019-nCoV) Nucleocapsid (SINO BIO, #40143-R019) or for fibrin (DAKO, #A0080) through LEICA BOND RX 1h room- temperature (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Cancer Biology 2020Quote: ... at 4°C overnight followed by incubation with Dako EnVision+System-HRP Labelled Polymer Anti-Mouse (Aglient Dako, Cat # K400111-2) for 60 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... by placing the virus for 2 minutes in a UV Stratalinker 2400 equipped with 365 nm long-wave UV bulbs (Stratagene, USA). UV-inactivation was confirmed by lack of cytopathic effect on BSC-1 cells infected with i-VACV for up to 3 days (data not shown).
-
bioRxiv - Biochemistry 2021Quote: ... was added to a final concentration of 0.5% along with 2 µL of PNGase F Ultra (Agilent Technologies, Santa Clara, CA) and incubated for 1 hour at 37 °C before subsequent 2-AB/2-AA labelling ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples for both the high pressure experiment and ambient pressure control experiment were prepared in 2 mL glass headspace vials (Agilent Technologies) whose caps were pierced with a needle.
-
bioRxiv - Genetics 2021Quote: ... The quality of the DNA was determined by agarose gel electrophoresis and by determining the OD260:OD280 ratio using a Nanodrop spectrophotometer (Epoch 2, Agilent BioTek). De novo genome sequencing was carried out by Novogene (www.novogene.com ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The optimal concentration was determined for each antibody: CD3 (polyclonal rabbit – anti-human CD3 IgG, cat. no. A045201-2, Agilent Technologies), 1:60 ...
-
bioRxiv - Developmental Biology 2021Quote: PSM cells were dissociated on day 2 of differentiation and reseeded onto fibronectin-coated Seahorse plates (Agilent cat. no. 101085-004) at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Biochemistry 2024Quote: ... ab109401 (1:5000)) or and anti-total Tau antibody (rabbit anti-human Tau, Dako, #A0024 (1:5,000)) diluted in 3% BSA in PBS-T overnight at 4°C shaking ...