Labshake search
Citations for Agilent :
2001 - 2050 of 3923 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Secondary antibodies used were goat Anti-Rabbit Immunoglobulins/HRP (1:10000, Agilent Dako, #P0448) or goat Anti-Mouse Immunoglobulins/HRP (1:10000 ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated with secondary goat anti-rabbit immunoglobulin-HRP (1:200, Dako P0488) for 45 min at room temperature After washing ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated with secondary goat anti-rabbit immunoglobulin-HRP (1:100, Dako P0488,) for 45 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and slides were incubated with the rabbit anti-goat Biotinylated (E0466, 1:200; DAKO) and the visualization system Envision anti Rabbit (K4033 ...
-
bioRxiv - Neuroscience 2024Quote: ... was diluted to 1:2000 in Dako Env FLEX Ab diluent (K800621-2, Dako) for 30 mins ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were incubated overnight with primary antibodies (GFAP, 1:500, Z0334, Dako, Carpinteria, CA), (Iba1 ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with 1:2000 horseradish peroxidase goat anti-mouse secondary antibody (Agilent #P044701-2) for 1 hour at RT in TBST with 5% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-human leukocyte antigen (HLA)-DR (1:200 Agilent, M0746, TAL.1B5 clone) in blocking solution overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... and anti-glial fibrillary acidic protein (GFAP; 1:50; Z0334; DAKO, Santa Clara, CA) in PBT overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-insulin polyclonal antibodies (Host: Guinea pig, 1:100; Dako, Santa Clara, CA, US) and Alexa Fluor® 488 anti-glucagon antibodies (Host ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was then incubated with HRP-conjugated anti-mouse immunoglobulins (1:2000) (Agilent, Santa Clara ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biophysics 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Cancer Biology 2021Quote: ... run 1 μl of sample on an Agilent Bioanalyzer High Sensitivity chip (Agilent, Cat#: 50674626) for cDNA QC & Quantification.
-
bioRxiv - Neuroscience 2020Quote: ... 1 μl of the odor sample was injected in a DB5 column (Agilent Technologies; www.agilent.com), fitted in an Agilent 6890 gas chromatograph ...
-
bioRxiv - Neuroscience 2021Quote: ... UK) overnight and anti-mouse IgG alkaline phosphatase-linked secondary antibody (1:5,000; Dako, USA). Membranes were incubated with CDP-Star chemiluminescent substrate (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... Target proteins were identified by the horseradish peroxidase-labeled streptavidin-biotin method (1:300, DAKO). In the immunofluorescence experiments ...
-
bioRxiv - Genomics 2020Quote: ... DNA was eluted into 53 µl with 1 µl used for D1000 TapeStation analysis (Agilent) and 2 µl used for Qubit quantification (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA was solubilized to an OD260 of 1 and analysed in the Bioanalyzer (Agilent) for quality and quantity estimation for RNA-seq ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies coupled with horseradish peroxidase (HRP): goat anti-mouse (Dako P0447, WB: 1/1000), goat anti-rabbit (Dako P0448 ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:150 dilution of rabbit anti-mouse immunoglobulins (Agilent/Dako, Glostrup, Denmark) for an hour ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Plant Biology 2020Quote: ... Purified VIPP1 at a concentration of 1 μM was injected onto a C18 column (Agilent Zorbax Eclipse Plus C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 µl aliquot of the sample was injected into Agilent GC-MSD (Agilent 7890B-5977B) system equipped with the Rxi-5Sil MS column (30 m × 0.25 mm × 0.25 μm film thickness ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used in this study: rabbit anti-GFAP (DAKO, 1:600), mouse anti-GFAP (Cell Signaling ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µL of sample was injected in splitless mode with an autosampler (Model G4513A, Agilent). Column flow was kept constant at 1mL min-1 with helium as a carrier gas ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were then antibody stained with guinea-pig anti insulin (1:500, Dako, Carpinteria, CA), Alexa Fluor 647 anti guinea-pig (1:1000 Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE, Agilent Technologie) at RT for 30min ...
-
bioRxiv - Cancer Biology 2021Quote: ... the following antibodies were used: anti-panCK (mouse, 1:1,000; DAKO, M3515, Clone AE1/AE3), anti-PHH3 (rabbit ...
-
bioRxiv - Physiology 2022Quote: ... fetal capillary endothelium and placental trophoblasts were distinguished using anti-vimentin (Dako Vim3B4: 1:100) and anti-pan cytokeratin (Sigma C2562 ...
-
bioRxiv - Microbiology 2022Quote: ... diluted 1: 50 with polymer-based EnVision FLEX detection system (Dako K8021, les Ulis - France) utilizing onboard Dako Omnisautomate OMNIS (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... and HRP-conjugated anti mouse IgG raised in goat (Dako-Agilent #P0447, dilution 1:500).
-
bioRxiv - Cell Biology 2020Quote: ... and HRP-conjugated anti mouse IgG raised in goat (Dako-Agilent #P0447, dilution 1:500).
-
bioRxiv - Microbiology 2021Quote: ... and type 1 IFN response (Mx1) was performed with MPO (Dako Cat. No. A0398; polyclonal) at 1:1000 detection using Rabbit Polink-1 HRP ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 20% fetal calf serum (FCS) and incubated with anti-insulin (1/10, Dako) in Antibody Diluent for 2h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were incubated at room temperature for 1 h with polyclonal goat anti-mouse (Dako) or anti-rabbit (Dako ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluates were pooled and applied to 1 ml of calmodulin affinity resin (Agilent Technologies). Beads were washed with 20 CV of buffer D / 1 mM DTT / 2 mM CaCl2 and bound protein eluted with 8 CV of buffer D / 1 mM DTT / 2 mM EGTA / 2 mM EDTA ...
-
bioRxiv - Cancer Biology 2021Quote: ... the following primary antibody combinations were used: a) Rabbit anti-CD3 (1:50, Dako A0452), incubated overnight ...
-
bioRxiv - Genomics 2021Quote: ... using a high-sensitivity NGS Fragment Kit (1-6000bp) (Agilent, catalog no. DNF-474-0500). Sequencing libraries were loaded on an Illumina NovaSeq6000 with PE 2 × 50 paired-end kits by using the following read length ...
-
bioRxiv - Developmental Biology 2021Quote: ... and biotinylated anti-rabbit IgG antibody which is produced in goats (E 0432-1 Dako Cyt ...
-
bioRxiv - Immunology 2021Quote: ... 1:2000 HRP-conjugated goat anti-rabbit polyclonal antibody (Dako, Denmark A/S, Cat#P0448) was added and the plate was incubated at 37°C for 1 h ...