Labshake search
Citations for Agilent :
1951 - 2000 of 5767 citations for Human Malonyl CoA Decarboxylase Mitochondrial MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... with the Quick Change Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Cat #210518). Similarly ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA quality was assessed using a Pico RNA kit for the BioAnalyzer (Agilent). We were able to extract good quality RNA from all but one sample (male head day2_20:00_c) ...
-
bioRxiv - Neuroscience 2020Quote: ... the Quick Change Lighting MultiSite-directed Mutagenesis kit (Agilent Technologies, Les Ulis, France) was used and the primers were as follows ...
-
bioRxiv - Pathology 2021Quote: ... After treatment with an enhancing reagent (EnVision Kit, DAKO Japan, Inc., Tokyo, Japan), immunohistologic localization of α-SMA was visualized by 3,3’-diaminobenzidine ...
-
bioRxiv - Plant Biology 2021Quote: ... Chimeric PCR products were subcloned before sequencing using StrataClone PCR cloning kits (Agilent).
-
bioRxiv - Microbiology 2021Quote: ... Mutant LGMN genes were generated using site-directed mutagenesis (QuikChange II kit; Agilent). Genes were amplified by PCR and inserted into the lentiviral vector pLVX-Hhi3 (gift from Sanford M ...
-
bioRxiv - Microbiology 2021Quote: ... Quality was checked using a 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode with a SP flow cell (2 x 50 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... and library size was determined using the Bioanalyser High Sensitivity DNA kit (Agilent). Libraries were diluted to 2nM and sequenced using the Illumina HiSeq 4000 platform the Genomics Facility at ICL to obtain paired-end 75bp reads.
-
bioRxiv - Cancer Biology 2020Quote: ... S838A/T841A substituted plasmid was made with QuikChange Site-directed mutagenesis kit (Agilent), following manufacturer’s recommendations and mutagenic primers TTAGTATCAATTGGTGAAGCATTCGGGGCTTCT GAGAAGTTCCAGAAA and TTTCTGGAACTTCTCAGAAGCCCCGAATGCTT CACCAATTGATACTAA ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies). cDNA was generated using Ovation RNA-seq System V2 (Tecan ...
-
bioRxiv - Cell Biology 2021Quote: ... site directed mutagenesis was performed with QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) and primers CEP78 mut_F and CEP78 mut_R (see Key Resources Table) ...
-
bioRxiv - Cancer Biology 2021Quote: Ser155 of MEOX2 was mutated using using QuikChange Site-Directed Mutagenesis Kit (Agilent). The mutagenic primer was CCGCCAGGCACTGGCACCTGCGGAGGC ...
-
bioRxiv - Cell Biology 2021Quote: ... Telomere FISH was conducted using the Telomere PNA FISH Kit/Cy3 (Dako, K5326) according to the protocol provided by the supplier.
-
bioRxiv - Cancer Biology 2021Quote: Metabolism profiling was carried out by Agilent Seahorse XFp Cell Energy Phenotype test kit on a Seahorse XFp analyser (Agilent). Protocols were carried out according to manufacturer guidelines and data was analysed using Agilent Seahorse Wave desktop V2.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and analyzed on a bioanalyzer using the Agilent RNA 6000 Pico Kit (Agilent). 2.5-10 ng of RNA per sample was used as input for library preparation.
-
bioRxiv - Cancer Biology 2021Quote: ... prior to OCR measurements using the XF Cell Mito Stress Kit (Seahorse Bioscience). Concentrations of oligomycin and FCCP were adjusted for each primary cell type ...
-
bioRxiv - Molecular Biology 2022Quote: ... equipped with a SYBR® Premix Ex Taq™ kit (Agilent Aria (v1.5) Software ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA integrity was assessed using Agilent RNA 6000 Nano Kit (Agilent Technologies, USA). RNA samples with RIN score ≥ 9 were used for the preparation of cDNA libraries.
-
bioRxiv - Immunology 2022Quote: ... Quality control was performed with Agilent Bioanalyzer High Sensitivity DNA kit (Agilent Technologies). Libraries were then purified ...
-
bioRxiv - Biochemistry 2022Quote: ... Quick-Change kit was used as indicated by the manufacturer (Agilent Technologies, USA). Full plasmid with CaMDR1 gene was amplified by using pre-designed primers harboring the desired mutation ...
-
bioRxiv - Molecular Biology 2022Quote: ... using a Prime-It Flour Fluorescence labelling kit (300380 version B, Agilent Technologies) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... All cells were measured using the Seahorse XF Glycolysis Stress Test Kit (Agilent) and Seahorse XF Cell Mito Stress Test Kit (Agilent ...
-
bioRxiv - Genetics 2022Quote: ... were incorporated by either site-directed mutagenesis (H596F) using the QuikChange kit (Stratagene) or restriction-free cloning (R313P ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies). cDNA was generated using Ovation RNA-seq System V2 (Tecan ...
-
bioRxiv - Neuroscience 2022Quote: ... Directed mutagenesis was performed with Quikchange II XL site-directed mutagenesis kit (Stratagene). For rescue and cell type-specific RNAi experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... The coverslips were further processed with Dako Kit (Cat # K5007, Dako, Agilent, U.S.A). The presence of target proteins was visualised using DAB as chromogen and the cells were counter stained with Haematoxylin and mounted with DPX mountant and examined under Nikon Eclipse E200 light microscope.
-
bioRxiv - Cancer Biology 2022Quote: ... The coverslips were further processed with Dako Kit (Cat # K5007, Dako, Agilent, U.S.A). The presence of target proteins was visualised using DAB as chromogen and the cells were counter stained with Haematoxylin and mounted with DPX mountant and examined under Nikon Eclipse E200 light microscope.
-
bioRxiv - Molecular Biology 2022Quote: ... were detected by EnVision+System-HRP (DAB) kits (Dako North America, Carpinteria, CA) and hematoxylin counter staining ...
-
bioRxiv - Genetics 2022Quote: ... Mutagenesis was done using the QuikChange II XL kit (Stratagene, La Jolla, CA). Rho-mCherry was previously used (39) ...
-
bioRxiv - Biophysics 2022Quote: ... The mutations were introduced using QuickChange II XL Site Directed Mutagenesis Kit (Agilent) and Q5 High-Fidelity PCR Kit (New England BioLabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity was quantified on Bioanalyzer (Agilent RNA nano kit 6000, #5067-1511) and Nanodrop 2000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes were synthesised using a Prime-it II Random Primer Labeling Kit (Agilent), 25 ng of target-specific DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). Mutated CYLD and TARDBP cDNA sequences were then subcloned ...
-
bioRxiv - Molecular Biology 2020Quote: ... The library quality was assessed using High Sensitivity DNA Kit (Agilent, #5067-4626). Paired-end sequencing (2×150 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... we used Agilent 2100 BioAnalyzer and High Sensitivity DNA Kit (Agilent Technologies, USA), and a qPCR-based KAPA library quantification kit (KAPA Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Mutagenesis was performed using the QuikChange XL Site-Directed Mutagenesis kit (200516, Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The unfragmented libraries were quality-controlled using a Bioanalyzer 2100 HS kit (Agilent). The libraries were then processed for tagmentation ...
-
bioRxiv - Genetics 2019Quote: Single point mutations were introduced into SCN5A using the QuikChange Lightning kit (Agilent) and verified by Sanger sequencing ...
-
bioRxiv - Immunology 2022Quote: ... RNA quality was quantified using the Agilent RNA 6000 Pico Kit (Agilent Technologies) following the manufacturer’s guidelines ...
-
bioRxiv - Genetics 2022Quote: ... Each variant of interest was introduced using the QuikChange Lightning Multi Kit (Agilent) with 1 primer per variant using primers designed using the online QuikChange Primer Design tool ...
-
bioRxiv - Microbiology 2022Quote: ... run using the RNA 6000 Pico and the High Sensitivity DNA Kit (Agilent), respectively ...
-
bioRxiv - Genetics 2019Quote: ... Mutations were introduced using the QuickChange XL II site-directed mutagenesis kit (Agilent) and mutation specific primers (Table 1) ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from cells using the Absolutely RNA Miniprep Kit (Agilent). cDNA was generated using Maloney murine leukaemia virus reverse transcriptase (MMLV-RT ...
-
bioRxiv - Microbiology 2019Quote: ... The Quick Change XL Site-directed mutagenesis kit (Stratagene, San Diego, California, USA) was used to generate the phosphomimetic KSRP-S193D-HA and non-phosphorylable KSRP-S193A-HA proteins ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were cloned using Strata Clone PCR Cloning Kit (Agilent, Santa Clara, USA). The 18S rRNA gene sequences from the isolates have been deposited in GenBank under the accession numbers XXXXXXX.
-
bioRxiv - Molecular Biology 2019Quote: ... The quality of all libraries was verified with the DNA-1000 kit (Agilent) on a 2100 Bioanalyzer and quantification was performed with Quant-It assays on a Qubit 3.0 fluorometer (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... Libraries were generated using the SureSelect Strand-Specific RNA Library Prep kit (Agilent) or Illumina’s TruSeq RNA Library Prep Kit (with polyA selection ...
-
bioRxiv - Molecular Biology 2019Quote: ... nRNA quality was assessed using the 2100 Bioanalyzer RNA 6000 Pico kit (Agilent), then nRNA was depleted of rRNA using the NEBNext rRNA depletion kit and the depletion efficiency evaluated using the Bioanlayzer RNA 6000 Pico kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mutations were introduced with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and confirmed by DNA sequencing ...
-
bioRxiv - Plant Biology 2019Quote: ... Site-directed mutagenesis of Avh195 was performed using the QuickChange II kit (Stratagene) according to the manufacturer’s recommendations ...