Labshake search
Citations for Agilent :
151 - 200 of 5382 citations for Rat Interleukin 7 Receptor IL7R ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2023Quote: ... After incubation with the rIgE’s the wells were washed four times with ELISA wash buffer and incubated with 100 μL of 1,3 μg/mL rabbit anti-human IgE-conjugated HRP (DAKO, cat no: P0295) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibodies used were goat anti-rabbit and rat anti-rabbit IgG-HRP (Dako, Santa Clara, CA, USA). Proteins were detected by chemiluminescence using the Clarity™ Western ECL Substrate coupled to a ChemiDoc XRS+(Bio-Rad ...
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples typically yielded >100ng of RNA with a RIN value of > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins were loaded in a Shodex PH-814a hydrophobic interaction chromatography column and eluted with a (NH4)2SO4 gradient in Hepes 25 mM pH 7 on a HPLC system (Agilent 1200, USA). The recovered fractions were separated by SDS-PAGE on 12% gels ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and incubated with biotinylated rabbit anti-rat IgG for 1h (1:200, DAKO Cytomation A/S, Denmark). Following avidin-biotin-peroxidase complex (Vector laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... After washing with TBST three times, membranes were exposed to appropriate secondary antibodies (anti-rabbit, anti-mouse, and anti-rat) coupled to HRP (Dako) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... slides were washed and incubated with the corresponding secondary antibodies when needed (rabbit anti mouse, Abcam; rabbit anti rat, Vector; Goat anti-rabbit, Dako) and visualization systems (Bond Polymer Refine Detection ...
-
bioRxiv - Neuroscience 2023Quote: Double immunofluorescence for activated pro- and anti-inflammatory microglial cells was performed as above with rat anti-CD86 (M1; 1:1600 dilution, Dako) and goat anti-CD206 (M2 ...
-
bioRxiv - Cancer Biology 2023Quote: Dual indexed whole exome capture libraries were prepared from mouse and naked mole-rat skin biopsies and matched livers using SureSelect XT HS and XT Low Input Enzymatic Fragmentation protocol (Agilent). For mouse whole exome sequencing (WES ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA samples yielded >280ng of RNA (>5.6ng/µl in a total eluate of 50µl) with a RIN value of generally > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2019Quote: The monkeys were scanned on an actively shielded 7-Tesla 68-cm horizontal bore scanner with a DirectDrive console (Agilent, Santa Clara, California) with a Siemens AC84 gradient subsystem (Erlangen ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 ml samples were injected with a split ratio of 7:1 into an Agilent GC-MS system (Agilent Inc, Palo Alto, CA) consisting of an 7890A gas chromatograph ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plates were then incubated at 37°C for 48 hours then analyzed by flow cytometry and ELISA or monitored for target cell death using xCelligence eSight (Agilent Technologies, Inc., Santa Clara, CA).
-
bioRxiv - Physiology 2022Quote: ... the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Blots were rinsed three consecutive times with Tris buffer (5min) and 1:10000 diluted donkey- or goat-anti-rat-HRP (Agilent Technologies) or 1:25000 diluted goat-anti-mouse-HRP (BioRad ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat, Cell Signaling Technology, Danvers, MA, Cat# CS7077S; HRP-mouse anti mouse, Dako, Agilent, Santa Clara ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat, Cell Signaling Technology, Danvers, MA, Cat# CS7077S; HRP-mouse anti mouse, Dako, Agilent ...
-
bioRxiv - Physiology 2022Quote: ... Immunologic), the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... 1:4000, rat anti-mouse IgG3-biotin (Becton, Dickinson, Franklin Lakes, New Jersey) 1:2000 followed by streptavidin-HRP (Dako, Glostrup, Denmark) 1:1000 incubated at 37°C for 1h.
-
bioRxiv - Bioengineering 2023Quote: ... bEnd.3 cells were seeded at a density of 6×103 cells/well in rat tail collagen-coated (150 µg/mL) 96-well plates (E-plate 96; Agilent, cat# 300600910) and confluent monolayers were treated as described above for human ECs ...
-
bioRxiv - Bioengineering 2023Quote: ... rat ECs were seeded at a density of 6×103 cells/well in 96-well plates (E-plate 96; Agilent, cat# 300600910) coated with collagen IV (100 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... A 140 bp region of alpha satellite sequence from chromosome 4 and a 349 bp region of HSATII from chromosome 7 were independently cloned into pTargeT™ DNA backbone via StrataClone TA cloning (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: The rate of debenzylation of 7-benzyloxyquinoline was measured with a real-time continuous fluorometric assay using a Cary Eclipse fluorometer (Agilent Technologies, Santa Clara, CA, USA) or a custom-modified PTI QM-1 fluorometer (Photon Technology International ...
-
bioRxiv - Neuroscience 2022Quote: ... In all rats, antibodies staining for neurons (Mouse anti-NeuN, MAB377, MiliporeSigma) and astrocytes (Rabbit anti-GFAP, Z0334, Dako/Agilent, Santa Clara, CA) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... In all rats, antibodies staining for neurons (Mouse anti-NeuN, MAB377, MiliporeSigma) and astrocytes (Rabbit anti-GFAP, Z0334, Dako/Agilent, Santa Clara, CA) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Telomere PNA Kit/FITC kit from Dako (Agilent) was used to estimate Telomere length signal in samples ...