Labshake search
Citations for Agilent :
151 - 200 of 963 citations for Polystyrene Latex Beads 5 um since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Products were purified using Ampure XP beads (1.5X) and quality controlled using a TapeStation (Agilent Technologies). Libraries were sequenced by paired end (2x75 bp ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using Ampure XP beads and quantified on an Agilent Bioanalyzer (G2939BA, Agilent) using the High-Sensitivity DNA kit (5067-4626 ...
-
bioRxiv - Microbiology 2020Quote: ... purified (Agencourt® AMPure® XP Beads) and quality-checked (High Sensitivity DNA Kit, Agilent Technologies). The final library was quantified (KAPA Library Quantification Kit ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were purified using Ampure XP beads and quantified on an Agilent Bioanalyzer (G2939BA, Agilent) using the High-Sensitivity DNA kit (5067-4626 ...
-
bioRxiv - Cell Biology 2021Quote: ... The supernatant was removed from the beads and desalted with Monospin C18 columns (Agilent Technologies, A57003100) as described in (Leene et al. ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified with TwistAmp Basic (Twist DX Ltd) and purified with AMPure XP beads (Agilent). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... After two more XP bead purifications (1:0.9) libraries were quantified using the Fragment Analyzer (Agilent). Libraries were equimolarly pooled before sequencing them with a length of 75 bp in single end mode on an Illumina NextSeq 500 system to a depth of at least 2 x 107 reads (GST-FERRY association screen ...
-
bioRxiv - Genomics 2024Quote: ... The SMRTbell library was purified with AMPure PB Beads and Agilent 2100 Bioanalyzer (Agilent Technologies, USA) was used to determine the size of the library fragments ...
-
bioRxiv - Plant Biology 2024Quote: ... Constructed libraries were purified by purification beads (Vazyme, N411) and analyzed on Agilent 2100 Bioanalyzer (Agilent) to measure fragment size distribution (around 150 bp) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from mRNA-ribosome-bead complexes using the Absolutely RNA Nano Prep Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3% Triton X-100 with 5% Goat Serum (Dako #X090710)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-mouse-HRP at 5 µg/ml (Dako, Cat # P0447).
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-dimethoxytrityl group was retained for HPLC purification (Agilent PLRP-S column ...
-
bioRxiv - Microbiology 2024Quote: ... and the plates were read with a Cytation 5 (Agilent) plate reader ...
-
bioRxiv - Immunology 2024Quote: ... endogenous peroxidases were blocked for 5 minutes (Agilent, ref. SM801) and then the slides were incubated with CD8 antibody (Histosure ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which was 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases were 70% 10 mM ammonium sulfate and 30% methanol ...
-
bioRxiv - Neuroscience 2024Quote: ... and counter stained for 5 minutes with automated hematoxylin (DAKO). Slides were then dehydrated through alcohol gradients and xylene before being coverslipped.
-
bioRxiv - Molecular Biology 2024Quote: ... which is 5 μm and 4.6 × 150 mm (Agilent, USA). The mobile phases of first-step HPLC separation were 95% ultrapure water with 0.1% (v/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The column (C18, 5 µm, 250 × 4.6 mm, Agilent, USA) was eluted at 30 °C using acetonitrile/water (4/6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 30min and imaged on the Cytation 5 (Agilent Technologies) using DAPI and RFP filters/LED cubes ...
-
bioRxiv - Cancer Biology 2024Quote: ... every 2nd day with a Cytation 5 instrument (Agilent Technologies). On day 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were read using a BioTek Cytation 5 (Agilent Technologies) wide-field imaging reader with a 20x air objective ...
-
bioRxiv - Genomics 2020Quote: ... The products were purified using AgencourtAMPure XP Beads and quantified using the Agilent DNA 12000 Kit (Agilent). Sequencing primer annealing and polymerase binding to the PacBio SMRTbell Templates were performed using the manufacturer’s recommendations (PacBio ...
-
bioRxiv - Immunology 2021Quote: ... Amplified libraries were purified by two-sided Ampure XP bead purification and validated on a Bioanalyzer (Agilent). 50 bp paired-end sequencing of pooled libraries was performed on an Illumina HiSeq2500.
-
bioRxiv - Cell Biology 2021Quote: RNP complexes bound to the beads were treated with 0.5 unit RNaseA+T1 mix (RNace-IT, Stratagene) in 100 μl PBS,2mM MgCl2 buffer for 10 min at 20°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were then amplified with TwistAmp Basic (Twist DX Ltd) and purified with AMPure XP beads (Agilent). Mitochondrial RNA baits for DNA capture were prepared in-house following the protocol (SM2 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were then amplified with TwistAmp Basic (Twist DX Ltd) and purified with AMPure XP beads (Agilent). Libraries for shotgun sequencing were indexed using unique iP5 and iP7 indices (Meyer & Kircher ...
-
bioRxiv - Evolutionary Biology 2024Quote: Libraries were cleaned to remove excess adapters and primers using Agilent beads (Agilent Technologies, Santa Clara, CA) at a 1:0.6 library to beads ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... ending with hold at 60% solvent B for 8.5 min – conducted on Agilent 4.6 mm x 250 mm RP Zorbax 300 A Extend-C18 column with 3.5 µm beads (Agilent). Collected fractions were concatenated and 5% of fractions were alqiuopted for global proteomic analysis ...
-
bioRxiv - Cancer Biology 2022Quote: ... beads were washed 2X with 80% ethanol and resuspended in TE buffer and quantified on a TapeStation (Agilent).
-
bioRxiv - Immunology 2020Quote: ... Fully amplified samples were purified with AMPure beads and quantified on the Bioanalyzer (Agilent Technologies, Santa Clara CA).
-
bioRxiv - Genomics 2020Quote: ... The amplified product was cleaned up using 1X ratio of AMPure beads on Bravo liquid handler platform (Agilent). Concentrations of purified product were measured with a dye-fluorescence assay (Quant-iT PicoGreen dsDNA High Sensitivity kit ...
-
bioRxiv - Immunology 2023Quote: ... Amplified products were purified with VAHTS DNA Clean Beads (Vazyme) and quantified using Qubit and 2100 Bioanalyzer (Agilent). Quantitative RT-PCR was used for quality control ...
-
bioRxiv - Developmental Biology 2022Quote: ... The amplified pre-capture library was purified by bead clean-up and quantified by Bioanalyzer DNA1000 assay (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Fully amplified samples were purified with AMPure beads and quantified on the Bioanalyzer (Agilent Technologies, Santa Clara CA). Libraries were sequenced on the HiSeq4000 platform (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... The amplified library was purified with AMPure XP beads and visualised using a HS DNA chip (Bioanalyzer, Agilent). The library was sequenced on a HiSeq2500 instrument with paired-end ...