Labshake search
Citations for Agilent :
151 - 200 of 466 citations for N 4 Hexyloxy phenyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality of the N=41 total RNA preparations was assessed on an Agilent TapeStation 4200 (Agilent, Santa Clara, CA, USA) and N=40 samples remained based on an RNA integrity number cut-off of > 5.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... The NDec1-98 mutant was prepared using purified N-His6 Dec plasmid DNA from a DH5α bacterial culture that was obtained using a StrataPrep plasmid miniprep kit (Agilent Technologies). Replacing codon 99 with a stop codon was accomplished by site-directed mutagenesis ...
-
bioRxiv - Cell Biology 2020Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange® Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... variants of CaMKII with N-terminal His6-SUMO tag were co-expressed with λ phosphatase in Escherichia coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) in LB medium at 16 □ for 24 h ...
-
bioRxiv - Genetics 2024Quote: ... the UV and LC-MS/MS raw data is batch processed (n=96, by plate) using Masshunter Qualitative Analysis (Agilent, Version 8.0) and Masshunter Quantitative Analysis (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... 2 μL of TEDAP (4 μM) underwent reverse-phase HPLC (Agilent PLRP- S reversed phase column 3.0 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... A P/O ratio of 2.75 has been validated for calculating the OXPHOS ATP production rate in cells (Romero N et al Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology). Thus ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Immunology 2023Quote: ... was amplified using primers listed in Table S2 and cloned into SrfI and EcoRI-linearized pCMVtag2B vector (N-terminal FLAG epitope-containing plasmid from Agilent Technologies, Cat# 211172) using Gibson Assembly (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... Hepta-N-acetyl Chitoheptaose (Cat. no.# 57/11-0010) were analyzed with TSK-Gel (Cat. no.# G2000SWx.) on HPLC (Agilent Technologies 1260 Infinity). The change in refractive index was observed over time for different samples ...
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Biochemistry 2024Quote: ... overnight at 4 °C) and blocking of endogenous peroxidase (peroxidase block; Dako) for 10 min at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Physiology 2022Quote: ... RNAs were extracted from n = 9 to 15 independent livers per group and RNA quality assessed using a TapeStation 4200 instrument (Agilent, Santa Clara, CA, USA). High quality RNA samples (RIN > 9.0 ...
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity, Agilent, Santa Clara, CA, USA). Fully expanded mature leaves were punched from the middle position to collect leaf discs using a size 10 (2.54 cm2 leaf area ...
-
bioRxiv - Cancer Biology 2023Quote: ... that were freshly obtained prior to start of pembrolizumab (n=32) using the companion diagnostic assay of pembrolizumab (PD-L1 IHC 22C3 pharmDx, Agilent Technologies, Carpinteria, CA, USA). When no fresh tumor biopsy was available ...
-
bioRxiv - Plant Biology 2024Quote: ... and the size of the library fractions were estimated from a smear analysis performed on the FEMTO Pulse® System (Agilent, P/N M5330AA).
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Immunology 2022Quote: ... pooled at 4 nM and quality-assessed on a 2100 Bioanalyzer (Agilent Technologies). Sequencing was performed on an Illumina MiSeq (paired-end ...
-
bioRxiv - Cancer Biology 2020Quote: ... SureFISH chr4 CEP 613kb green for the centromere of chromosome 4 (#G101066G, Dako), FISH RAMP1 red for the RAMP1 gene (#G110996X-8 ...
-
bioRxiv - Immunology 2021Quote: ... Cy-dye labelling and hybridization to Agilent High Definition 4×44k array (Agilent technologies ...
-
bioRxiv - Physiology 2022Quote: ... We used a Mouse Gene Expression 4 × 44K Microarray chip (G4846A, Agilent Technologies), which can examine 23,215 genes as described [30] ...
-
bioRxiv - Immunology 2024Quote: ... Each sample was run on a 4% agarose gel and TapeStation 4150 (Agilent) to verify the presence of PCR products of the appropriate size (383 bp) ...