Labshake search
Citations for Agilent :
151 - 200 of 2977 citations for 7 Hydroxy 4 methoxy 1 indanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Biophysics 2023Quote: ... 104 and 140) cDNA in pET-7 vector was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of four single cysteine mutants (T26C ...
-
bioRxiv - Physiology 2023Quote: ... RNA concentration and integrity (RIN>7 for all samples) was assessed via Qubit fluorometric quantitation and tapestation bioanalyzer (Agilent), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... The samples containing an RNA integrity number (RIN) ≥ 7 were checked using the Agilent Bioanalyzer 2100 (Agilent Technologies, USA) and considered qualified for library preparation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each input was amplified and sequenced from three independent PCRs [7 cycles each using Taq Precision Plus (Agilent Technologies)] ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed by NanoDrop ND-1000 (260/280 >2; ThermoScientific) and by RNA ScreenTape (RIN ≥7; Agilent). Samples were then sent to the TCAG Microarray Facility at Sick Kids Hospital (Toronto ...
-
bioRxiv - Biophysics 2024Quote: The α-Syn WT containing plasmid pT7-7 was mutagenized using the QuickChange II site-directed mutagenesis protocol (Agilent). The primers used for the mutagenesis can be found in Table S1 ...
-
bioRxiv - Biophysics 2024Quote: ... The measurements were acquired for 24 hours at 7-minute intervals in a microplate reader (Agilent BioTek Synergy H1) at 298 K ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PVDF membranes were blocked in 5 % nonfat dry milk diluted in Tris-buffered saline with 0.05 % Tween-20 for 1 h at room temperature and then incubated overnight at 4 °C with antibodies against FN (1:70000, rabbit anti-fibronectin, DAKO, Hamburg, Germany). After washing with TBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Adapter dilution (1:4) and PCR amplification (26 cycles) were optimized in a pilot experiment using Bioanalyzer DNA1000 (Agilent, Sant Clara, USA) chips as a read out of library size and quantity ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were imaged on brightfield every 6h in a 48h time course with a 4X PL FL magnification in a Cytation 7 automated microscope (Agilent). Cell count was performed using the Gen5 (v.3.12 ...
-
bioRxiv - Immunology 2024Quote: ... Plates were briefly centrifuged and then imaged at 6-hour intervals for mCherryNLS fluorescence using the BioTek Cytation 7 Cell Imaging Multimode Reader (Agilent) integrated with the BioTek BioSpa 8 Automated Incubator (Agilent) ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2024Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Biochemistry 2024Quote: The A30P αSyn plasmid was prepared by site-directed mutagenesis of the pT7-7 WT αSyn plasmid using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated in a humidified and gas-controlled environment and imaged using a tandem BioSpa and Cytation 7 Cell Imaging Multimode Reader (BioTek/Agilent) as described previously[29] ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated overnight at 4°C with the respective primary antibodies: (i) polyclonal rabbit anti-GFAP (1:2000; Dako, Cat. No. Z0334); (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
A gated hydrophobic funnel within BAX binds long-chain alkenals to potentiate pro-apoptotic functionbioRxiv - Cell Biology 2024Quote: SPARKL experiments performed using a Cytation 7 equipped with an inverted imager (Model CYT7UW-SN, BioTek/Agilent, Santa Clara, CA, USA) tethered to a BioSpa 8 automated incubator (Model BIOSPAG-SN ...
-
bioRxiv - Plant Biology 2024Quote: ... Vials were placed on ice and illuminated for 7 min in “time mode” using a UV-crosslinker with a 254 nm light source (Stratalinker Model 1800, Stratagene, USA). Each sample had a corresponding photolysis negative control ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...