Labshake search
Citations for Agilent :
151 - 200 of 311 citations for 7 Chloro 8 fluoroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-matched primary tumor tissues and PDTOs were immunostained for diagnostic NSCLC markers with antibodies against cytokeratin (CK)7 (mouse, M7018, 1:100; Dako), CK5/6 (mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: Cybrid cells were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent, 103010-100). The day of the assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome, Agilent Technologies, design ID 074809) and subsequent washing and drying of the slides were performed following the Agilent hybridization protocol in Agilent hybridization chambers ...
-
bioRxiv - Physiology 2021Quote: ... Génopole Toulouse Midi-Pyrénées) using Sureprint G3 Mouse GE v2 microarrays (8×60K, design 074809, Agilent Technologies), according to the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200 μl of distilled water was added to the sensor-containing Seahorse 8-well fluxpaks (Agilent Technology), which were coated with Poly-D-Lysine ...
-
bioRxiv - Biochemistry 2019Quote: ... all samples were processed and hybridized to SurePrint G3 Mouse Gene Expression 8 × 60 K (Agilent Technologies). Fluorescence was detected using Agilent DNA Microarray Scanner ...
-
bioRxiv - Neuroscience 2023Quote: Neurospheres were removed from 96-well plates and pipetted into 8-well Seahorse XF HS miniplates (Agilent) coated with 15 µg/mL poly-L-ornithine and 10µg/mL laminin ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Immunology 2024Quote: Initial experiments were conducted with an 8-well Seahorse XFp extracellular flux analyser (Seahorse Bioscience, Inc, USA) to determine cell seeding density and FCCP concentration (Supplementary Data) ...
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.75 μg labeled cRNA was fragmented and hybridized to custom whole-genome human 8 × 60K microarrays (Agilent-048908) according to the supplier’s protocol (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a genome-wide gene expression profiling was set up using the 8×60K ArrayXS Zebrafish platform by Agilent and performed by OakLabs GmbH (Henningsdorf ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3-labeled RNAs were hybridized to SurePrint G3 Mouse Gene Expression v2 8×60K Microarray Kit (Agilent Technologies) at 65 °C for 17h ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 8 min (Dako, X0909). Primary CD133 antibody (Miltenyi Biotec ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: The complete RNA library was hybridised to SurePrint G3 Mouse GE 8×60K Microarrays (Agilent, Cat No. G4852A) using a partially modified version of manufacturer’s protocol as described in Version 6.9.1 of ‘One-Color Microarray-Based Gene Expression Analysis Protocol’ ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide microarrays for human whole genome (G4858A design 072363, 8×60k chips SurePrint G3 unrestricted GE, Agilent Technologies) were used for global gene expression analysis ...
-
bioRxiv - Genomics 2021Quote: Submicroscopic CNVs were identified in patients referred for genetic diagnosis through the 8×60k ISCA platform (Agilent Technologies), with a mean actual resolution of about 120 kb ...
-
bioRxiv - Genetics 2019Quote: DNA from patient LA was tested using an 8 x 60K SurePrint G3 custom CGH + SNP microarray (Agilent) and analysed using Agilent Cytogenomics software 4.0 ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quick Amp Labeling Kit and SurePrint G3 Human Gene Expression 8×60Kv3 Microarray (Cat. No. G4851C, Agilent Technologies) was used corresponding to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA integrity was assessed using an Agilent 2100 Bioanalyzer (cutoff value of RIN 8 or higher; Agilent Technologies). cDNA libraries were clustered onto a TruSeq paired-end flow cell ...
-
bioRxiv - Microbiology 2023Quote: ... 1.8 μm) and a guard column Zorbax Eclipse Plus C18 (2.1 × 5mm, 1.8 μm) both provided by Agilent technologies (Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... OCR and ECAR were measured using an 8-well Seahorse XFp Analyzer according to manufacturer’s instructions (Agilent Technologies). In brief ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant adeno-associated viruses (AAVs) with serotype 8 were produced using the AAV helper-free system (Agilent Technologies). Human embryonic kidney (HEK ...
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring OD600 every 2.5 min for 8 hours using a BioTek 800 TS (Agilent) with continuous ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Cy3-labeled aRNA was hybridized overnight to 8 x 60K 60-mer oligonucleotide spotted microarray slides (Agilent Technologies ...
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples typically yielded >100ng of RNA with a RIN value of > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins were loaded in a Shodex PH-814a hydrophobic interaction chromatography column and eluted with a (NH4)2SO4 gradient in Hepes 25 mM pH 7 on a HPLC system (Agilent 1200, USA). The recovered fractions were separated by SDS-PAGE on 12% gels ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Cell Biology 2020Quote: Gene expression analysis were performed with Agilent® SurePrint G3 Human GE 8×60K Microarray (Agilent Technologies, AMADID 39494) with the following dual-color design ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA Integrity was ensured by obtaining an RNA Integrity Number - RIN >8 with Agilent 2100 Bioanalyzer (Agilent Technologies, Germany).
-
bioRxiv - Immunology 2022Quote: ... and the resulting peptides were captured and desalted by C-8 trap column (2.1 × 20 mm, Zorbax Eclipse XDB-C8 trap (Agilent) followed by loading on to C-18 column (2.1 × 50 mm in size ...
-
bioRxiv - Physiology 2020Quote: ... 20 μL samples were injected into Hi-Plex H column (300×7.7 mm; 8 μm particle size, Agilent Tech.). 0.1% formic acid in Milli-Q water (Merck Millipore ...