Labshake search
Citations for Agilent :
151 - 200 of 1296 citations for 6 Methyl 5 propyl 4 1H pyrimidinone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... RNA quality (RNA integrity number > 6) was confirmed via Fragment Analyzer (Agilent, USA). RNA was treated with DNase I and reverse-transcribed using SuperScript III (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... Peptides were first loaded onto a C18 trap column (5 µm, 5 × 0.3 mm, Agilent Technologies) and then eluted into a C18 analytical column (75 μm × 150 mm ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μm particle size (Agilent Technologies) was employed for metabolite separation with a linear gradient of 95:5 A/B to 30:70 A/B over 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 5% donkey serum (Dako) in PBS and incubated with primary antibody (α-TFAM (Mouse ...
-
bioRxiv - Bioengineering 2024Quote: ... BioTek Cytation 5 Cell Imager (Agilent) was used to take RFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... with Gen 5 imaging software (Agilent) taken at 4x.
-
bioRxiv - Cancer Biology 2024Quote: ... with Gen 5 imaging software (Agilent) taken at 4X ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Biochemistry 2023Quote: ... using a C8 reverse phase micro-column (Zorbax 300SB-C8, 5 µm, 5 × 0.3 mm, Agilent Technologies). The sample was then eluted with 70% of mobile phase B (flow rate of 50 µl/ min ...
-
bioRxiv - Immunology 2021Quote: ... mouse thymocytes were exposed to 254 nm UV-irradiation for 6 minutes (Stratagene Stratalinker) followed by labelling with 2 μM CFSE (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... the heat-induced antigen retrieval was performed in Target Retrieval solution (pH 6) (Dako) for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was carried out using citrate buffer solution pH 6 (Dako, Glostrup, Denmark). Detection was performed using the EnVision method (Dako ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: guinea pig anti-insulin 1:6 (Agilent, IR002), rabbit anti-glucagon 1:200 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2023Quote: Heat-induced antigen retrieval was performed in either Target Retrieval solution (pH 6) (Dako) or in EDTA (pH 8.5 ...
-
bioRxiv - Physiology 2024Quote: ... antigen retrieval was performed in boiling 10 mM citrate buffer pH 6 (Dako; #S2369) for 30 min and sections were incubated 30 min with Fab antibody ...
-
bioRxiv - Developmental Biology 2024Quote: Cas13d mediated knockdown at 6 hpf: High quality RNA once passed through Bioanalyzer (Agilent) with RIN score more than 7.5 were used for library preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... squashed specimens were placed in DAKO Real Target Retrieval Solution (pH 6) (S2031; DAKO) and heated in a microwave oven (MI-77 ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Biochemistry 2024Quote: ... Pulsed-splitless injection was used to apply 5 μL samples to a HP-5 ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies; 30 m X 250 μm X 0.25 μm) at an inlet temperature of 220°C and a transfer temperature of 240°C ...
-
bioRxiv - Cell Biology 2020Quote: ... at 5 ng/μl and pBSKS (Stratagene) at 70 ng/μl for a total of 100 ng/μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 minutes with Liquid DAB (Dako). Samples were counterstained with hematoxilin.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 µm (Agilent Technologies, Santa Clara, CA). The following HPLC conditions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) was used for peptide separation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) constituted the stationary phase ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl Fe(III)-NTA cartridges (Agilent) were primed with 100 μL of 0.1% TFA in H2O and equilibrated with 50 μl 0.1% TFA in 80% ACN [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... C18 cartridges (Agilent, 5 µL bed volume) were primed with 100 µL 90% acetonitrile (ACN ...
-
bioRxiv - Neuroscience 2024Quote: ... High pH kit reagents (K800021-5, Dako). pSer202/Thr205-tau antibody (MN1020B ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM HEPES (Agilent, Cat. # 103337-100 ). Cells were plated in Seahorse 96 well plates (Agilent ...
-
bioRxiv - Systems Biology 2024Quote: ... Fe(III)-NTA cartridges (Agilent, 5 µL) were initially primed with 100 µL of 50% MeCN/0.1%TFA and equilibrated with 50 µL of 80% MeCN/0.1% TFA ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Biochemistry 2024Quote: ... pre-incubated for at least 30 min at 6 °C within the Vialsampler (G7129A, Agilent), and then loaded on a Superdex 200 Increase 10/300 column (Cytiva ...
-
bioRxiv - Cancer Biology 2024Quote: ... were separated by injecting 5 μL sample on a ZORBAX SB-C18 column (2.1*50 mm, 5 µm, Agilent). The mobile phase was as follows ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Plant Biology 2024Quote: ... A splitless injection volume of 1 μL was injected onto an HP-5 column with 5% phenyl methylpolysiloxane stationary phase (Agilent) with dimensions of 30 m x 0.25 mm x 0.25 μm ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...