Labshake search
Citations for Agilent :
151 - 200 of 1830 citations for 3 Phenoxybenzoic Acid Unlabeled 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The extracts were acidified to pH 2 and additionally pre-treated with solid-phase extractions using Agilent Bond Elut-PPL 3 mL columns and diluted to 50 ppm (Agilent Technologies, DE, USA) following standard lab protocol29 ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The oxygen consumption rate (OCR) was detected in the mitochondria (10 ug/well) with the Seahorse XFe24 (Seahorse Bioscience, Agilent, Santa Clara, USA) to detect the coupling capacity ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The oxygen consumption rate (OCR) was detected in the mitochondria (10 ug/well) with the Seahorse XFe24 (Seahorse Bioscience, Agilent, Santa Clara, USA) to detect the coupling capacity ...
-
bioRxiv - Cancer Biology 2022Quote: ... (Agilent 103575-100) with 2mM glutamine (Agilent 103579-100) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2023Quote: ... A glucose-free assay medium was prepared by mixing 10 ml of Seahorse XF base medium minimal DMEM (Agilent 103334-100), 100 µl Na pyruvate (Sigma S8636) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... For phthalates and BPA extraction we used Agilent Vac Elut Manifold with SPE cartridge C18 ODS 3 ml tubes 200 mg (Agilent Santa Clara CA, USA). SPE cartridges were conditioned with 2 ml of methanol and then 2 ml of MilliQ water ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Microbiology 2021Quote: ... The fatty acid profiles were analyzed by gas chromatography (Agilent 7890A) using the RTSBA6 method/library ...
-
bioRxiv - Genetics 2021Quote: ... and organic acids by a dual-wavelength absorbance detector (Agilent G1314F).
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti glial fibrillary acid protein (Abcam, GFAP, Dako Z0334 1:1000); Anti CD68 (Biorad MCA1957 ...
-
bioRxiv - Neuroscience 2022Quote: ... and glial fibrillary acid protein (GFAP; Z0334, Dako, RRID:AB_10013382, 1:500) were performed as previously described (Muñoz-Manchado et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
bioRxiv - Immunology 2023Quote: ... IgG from 100 µl of human plasma (∼100 µg/100 µl) was pre-enriched using the Protein G AssayMAP Bravo (Agilent) technology as described above ...
-
bioRxiv - Biochemistry 2022Quote: ... The metabolite-containing supernatant (195 µL) was transferred into pre-cut Bond® Elut PH (100 mg, 1 ml) SPE cartridges (Agilent, 12102005) placed in 1.7 mL microcentrifuge tubes and then centrifuged at ∼3000 g for 3 min ...
-
bioRxiv - Immunology 2023Quote: ... After incubation with the rIgE’s the wells were washed four times with ELISA wash buffer and incubated with 100 μL of 1,3 μg/mL rabbit anti-human IgE-conjugated HRP (DAKO, cat no: P0295) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... OMIX C18 tips (100 µL) were ordered from Agilent (A57 003 100). Mouse anti-β-actin antibody (A1978 ...
-
bioRxiv - Cell Biology 2021Quote: ... MyoD (1:100, Dako) and Myogenin-concentrate (1:10 ...
-
bioRxiv - Microbiology 2023Quote: ... 100 Å column (Agilent) based on previously described methods56 ...
-
bioRxiv - Plant Biology 2023Quote: ... Lipid bands were scratched from the plates and their fatty acids extracted (fatty acid methyl esters FAMEs) and quantified by GC-MS (Agilent 7890 A and MSD 5975 Agilent EI) as in (39) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed with 100 μL XF Base medium (Seahorse Bioscience 102353-100) which has been adjusted to pH 7.4 at 37 °C with 0.1M NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then washed 1X with 200 mL warm ATP Assay Medium prepared per protocol (Agilent XF DMEM Medium pH 7.4 (103757-100); 10 mM XF Glucose ...
-
bioRxiv - Cell Biology 2022Quote: ... OCI-LY-1 cells (5 × 105 cells/ml) were pretreated for 1 hour in Seahorse Seahorse XF base medium supplemented with glutamine (103334-100, Agilent Technologies, Heverlee, Belgium) in a CO2-free incubator ...
-
bioRxiv - Cell Biology 2022Quote: OCI-LY-1 cells (5 × 105 cells/ml) were washed twice in prewarmed PBS and resuspended in Seahorse XF base medium supplemented with glutamine (103334-100, Agilent Technologies, Heverlee, Belgium). Cells were treated with compounds of interest as indicated ...
-
bioRxiv - Plant Biology 2020Quote: The contents of celastrol and wilforic acid A were analyzed by Agilent 1260LC-6400 QQQ (triple quadrupole mass) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4 (Agilent, 103576-100) supplemented with 10 mM Glucose (Agilent ...
-
bioRxiv - Bioengineering 2019Quote: ... S-100 (1:250, Dako), and/or (v ...