Labshake search
Citations for Agilent :
151 - 200 of 3323 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Biochemistry 2023Quote: ... Antigen retrieval was performed with Citrate Buffer (pH 6) (Dako, Glostrup, Denmark). Immunohistochemical staining was performed with anti VEGFA or anti-S100A8 (Table I) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... or 1 µM (OMM1) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 µM of a rotenone antimycin A mix (Agilent Technologies). Following the assay ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasma (50 µL) was diluted with 150 µL of buffer A (1:4 dilutions, as recommended by Agilent Technologies), and then filtered to remove particulates using a 0.45 μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were incubated in 0.1% Triton with 2% goat serum in PBS at 4°C overnight: rabbit anti-GFAP (1: 1000, DAKO, Z0334), rabbit anti-IBA-1 (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... Half of the cDNA was amplified for 17 PCR cycles and a 1:4 dilution of the resulting library was assessed by Agilent Bioanalyzer High Sensitivity DNA kit ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed in 4% PFA and sequentially stained with mAbs to NPM (anti-human/mouse nucleophosmin (NPM) (clone 376, dilution 1:50, Dako) and anti-mouse MPO (Millipore) ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody incubation was performed overnight at 4 °C with rabbit monoclonal anti-PSyn EP1536Y diluted 1:320,000 in DAKO antibody diluent (Agilent #S0809). After three 5-min washes with PBST ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples were incubated for 2 h at 4℃ in a guinea pig anti-insulin antibody (1:200, A0564, Dako), a rabbit anti-somatostatin antibody (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed with Bond Wash buffer 3 x 30s and then incubated with either mouse anti-CD68 (M0814, 1:100, Dako, Carpenteria, CA), mouse anti-βIII-Tubulin (G7121 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were then incubated overnight at 4°C with primary polyclonal anti-GFAP rabbit antibody (1:1000; Z0334, DAKO, Golstrup, Denmark) or anti-collagen IV rabbit antibody (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasma (50 μL) was diluted by adding 150 μL of Agilent buffer A (1:4 dilutions, as recommended by Agilent Technologies), then filtered using a 0.45μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... The Samples were diluted 4 fold with water and 1 μl supernatant was loaded on a Bioanalyzer High Sensitivity DNA electrophoresis chip (Agilent Technologies).
-
bioRxiv - Zoology 2020Quote: ... hydrated through graded ethanol and incubated overnight at 4°C with a mouse anti-human CD68 clone KP1 monoclonal antibody (1:100, Dako, Denmark). Then ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Immunology 2023Quote: ... pH 7.4) for 1 h without CO2 prior to measurement of O2 consumption and extracellular acidification rate (ECAR) by XFe24 (Seahorse Bioscience) with sequential addition of 1 μM of oligomycin ...
-
bioRxiv - Immunology 2024Quote: ... the cells were washed once with PBS-EDTA and fixed with 1% paraformaldehyde before FACS analysis with a 4-laser (405, 488, 561 and 637 nm) Quanteon Novocyte (Agilent Technologies).
-
bioRxiv - Molecular Biology 2024Quote: ... After incubation the cells were fixed in 4 % PFA and stained with rabbit anti human C3c FITC (1: 100 Dako F020102) antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Immunology 2024Quote: ... The antigens on the slides were retrieved by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent, Cat# S2375) and incubating at 97 °C for 40 min in a Lab Vision PT Module (Thermo Fisher Scientific) ...