Labshake search
Citations for Agilent :
1901 - 1950 of 2942 citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Immunology 2023Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... The optical density was measured at 540 nm and subtracted from readings at 450 nm using the BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). Concentrations were calculated from standard curves run in parallel.
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... The 75th amino acid in the PB1-F2 protein was changed to a histidine (H) via site directed mutagenesis (QuikChange Lightning, Agilent) to produce the PB1-F2-75H plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MBP-Tlg21-327 and the co-expressed Vps45–Tlg2 proteins were expressed and purified in a similar manner with the following modifications: protein was overexpressed in BL21-Codon Plus (Agilent); after IPTG addition the cells were grown at 16°C ...
-
bioRxiv - Cell Biology 2020Quote: Samples from all biological replicates were first sent to the Stanford University Protein and Nucleic Acid Facility (Stanford, CA) for quantification and quality analysis using a 2100 Bioanalyzer (Agilent). Samples were then sent to Novogene Corporation Inc ...
-
bioRxiv - Biophysics 2021Quote: ... The plasmid encoding the protein fused with a His-tag at the N-terminus was transformed in BL21 DE3 pLysS strains (Agilent). Recombinant αE-catenin was expressed via isopropyl 1-thio-β-d-galactopyranoside (IPTG,Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: Affinity purification and digestion of biotinylated proteins were carried out in an automated fashion in a Bravo AssayMap platform (Agilent) using AssayMap streptavidin cartridges (Agilent) ...
-
bioRxiv - Cell Biology 2019Quote: ... All the mutant versions of recombinant proteins were produced by QuickChange Mutagenesis kit to mutate the plasmid DNA (Agilent Technologies). The MAD1 fragments and Cyclin B1 were transformed into BL21(DE3 ...
-
bioRxiv - Immunology 2019Quote: Purified recombinant His-tagged C-terminal MSP1 protein (amino acids 4960 to 5301) (Ndungu et al., 2009) was biotinylated and tetramerized with streptavidin-PE (Prozyme), as previously described (Krishnamurty et al. ...
-
bioRxiv - Physiology 2021Quote: ... Samples were washed with PBS twice and were either blocked for 10 min at room temperature (Dako protein block #X0909), or with goat block (GB ...
-
bioRxiv - Physiology 2021Quote: ... Samples were washed with PBS twice and were either blocked for 10 min at room temperature (Dako protein block #X0909), or with goat block (GB ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... Seahorse data were normalized to total amount of protein (μg) and mitochondrial respiration parameters were analyzed using Wave Desktop 2.6 software (Agilent Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... The free HSF2BP protein as well as the complex between ARM and F15X were analyzed using a Bio SEC-3 column (Agilent) equilibrated in 25 mM Tris-HCl buffer ...
-
bioRxiv - Neuroscience 2020Quote: Site-directed insertions were made in GluN1 (GluN1-a) (NCBI Protein database accession no. P35439) or GluN2A (Q00959) subunits with the QuikChange site-directed mutagenesis kit (Agilent) with XL1-Blue super-competent cells ...
-
bioRxiv - Plant Biology 2022Quote: His6-MBP-PFA-DSP protein fusions or free His8-MBP were expressed in Escherichia coli BL21 CodonPlus (DE3)-RIL cells (Stratagene). Overnight bacterial cultures were inoculated 1:1000 into fresh 2YT medium (1.6 % tryptone ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sections were washed with TBST (Tris Borate Saline Tween-20) and then blocked with Protein Block Serum-Free (Ref: No X0909, Dako) for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... A plasmid coding for the fusion protein with a K1432A substitution in the RemA CTD was made by the QuikChange mutagenesis (Agilent) using primers PG007 and PG008.
-
bioRxiv - Microbiology 2020Quote: ... A construct expressing the MBP-MogRQN→AA protein was created by site-directed mutagenesis of pMAL-p5x-mogR using the QuikChange II Site-Directed Mutagenesis Kit (Stratagene) with the same primers as for pHT304-Pxyl-MogRQN→AA ...
-
bioRxiv - Biochemistry 2020Quote: ... and the fluorescence signals corresponding to temperature-dependent protein unfolding were measured using a Real-Time PCR Mx3005p machine (Stratagene). The melting temperature calculation was performed as described previously46.
-
bioRxiv - Biophysics 2022Quote: 30 µl EPYC1 and 30 µl Rubisco proteins were mixed in the cuvette for measurement in the Cary 60 UV-Vis spectrophotometer (Agilent). After 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... and the fluorescence signals corresponding to temperature-dependent protein unfolding were measured using a Real-Time PCR Mx3005p machine (Stratagene). Melting temperature shifts were calculated using the previously described method61.
-
bioRxiv - Neuroscience 2021Quote: ... to test the presence of electrical coupling between THINs and NGF interneurons we used double transgenic TH–Cre crossed with (BAC) transgenic mice that express the humanized Renilla green fluorescent protein (hrGFP) (Stratagene) under the control of the mouse NPY promoter (NPY-GFP ...
-
bioRxiv - Pathology 2020Quote: ... Sections were allowed to thaw at RT and thereafter blocked for > 60 min at RT with blocking-buffer (serum-free protein blocking solution, DAKO), supplemented with 0.2% Triton X-100 (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: 100 μL of purified recombinant protein (at approximately 2 mg/mL) were loaded onto a sizeexclusion chromatography column (PL1580-3301, Agilent) in the phosphate buffer (20 mM Tris ...
-
bioRxiv - Biophysics 2019Quote: ... Major interfering proteins were removed from the serum by the Multiple Affinity Removal Spin Cartridge HSA/IgG (Agilent Technologies, USA) as described into manual ...
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Biophysics 2020Quote: ... bound to precursor protein was analysed by SDS-PAGE and liquid chromatography coupled to mass-spectrometry (LC ESI-TOF MS, 6210, Agilent Technologies ...
-
bioRxiv - Biophysics 2020Quote: His-tagged CrSAS-6[NL] spanning amino acids 1-503 of the protein (see Supplementary Fig. 1a)1 was expressed in the Escherichia coli strain BL21(DE3) (Stratagene). Bacteria were grown at 37 °C in lysogeny broth (LB ...
-
bioRxiv - Immunology 2021Quote: ... and by SEC-HPLC with an xbridge protein BEH SEC (Waters, ref. 186009160) connected to a HP1100 system (Agilent Technologies).
-
bioRxiv - Molecular Biology 2022Quote: ... whole protein lysates for each well were quantified by BCA assay and total protein amounts were used for normalization of Seahorse data using Wave Software (Agilent). Basal OCR ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Cell Biology 2022Quote: ... sor1-D303A and sor1-Y305A variants proteins) were introduced into the cloned sor1 gene using the QuikChangeII kit (Agilent Technologies) and inserted into the genome by transformation.
-
bioRxiv - Molecular Biology 2023Quote: The above 12 OR genes linked to a wild-type internal ribosome entry site from the encephalomyocarditis virus (EMCV IRES) and the mCherry fluorescent protein gene (Shaner et al., 2004) were inserted into a modified pBlueScript KS (Agilent/Stratagene) called plasmid “L” (Zboray et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... CLEANEX and DOSY data were collected on 100 μM 15N-labelled protein at a proton Larmour frequency of 600 (Agilent) or 800 (Bruker ...
-
bioRxiv - Microbiology 2023Quote: Yeast proteins under both conditions were extracted and later subjected to fractionation through 3100 OFFGEL (Agilent Technologies, Palo Alto, CA) followed by an identification by LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Vectors encoding the recombinant proteins were constructed as described in the previous section and introduced into the BL21-CondonPlus (DE3)-RIL competent cells (Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Antigen retrieval was then performed for 20 minutes at 95°C using Lecia Epitope Retrieval Buffer 2 followed by treatment with Dako serum-free protein block (X090930-2, Agilent Dako) for 15 minutes to prevent non-specific binding of the antibody ...
-
bioRxiv - Biochemistry 2023Quote: His6-SUMO-tagged and His6-SUMO-SNAP-tagged Tm1 protein constructs and GST-Khc 1- 365 were expressed in BL21-CodonPlus(DE3)-RIL cells (Stratagene) by isopropyl β-D-1- thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2023Quote: The murine and human proteins (variants R166H and R168H, respectively) were produced in E.coli BL21 CodonPlus(DE3) RIL (Agilent Technologies) carrying the plasmid pHisTrx-mα-DGN and pHisTrx-hα-DGN ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples of trypsin-digested proteins were analyzed using the 1200 series LC system and LTQ-Orbitrap-XL mass spectrometer (Agilent and Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Cell Biology 2023Quote: ... For staining of macrophages and platelets the aortic tissue sections were blocked for 1 h at RT with protein blocking solution (#X0909, Dako). After blocking ...