Labshake search
Citations for Agilent :
1901 - 1950 of 6919 citations for Nitrite Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Genomics 2019Quote: All libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and checked for fragment size using the TapeStation D1000 kit (Agilent). The libraries were pooled in equimolar concentration for a total pooled concentration of 2nM ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen) and a qPCR add-on kit after which they were run on a Fragment Analyzer (Agilent), equimolar pooled and sequenced using an Illumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Genomics 2023Quote: ... RNA concentration and quality was measured using Agilent RNA 6000 Nano Kit and RNA 6000 Pico Kit (5067-1511 & 5067-1513, Agilent) on Agilent 2100 Bioanalyzer (Fig ...
-
bioRxiv - Molecular Biology 2023Quote: cDNA libraries were generated from RNA samples by using Kapa RNA HyperPrep Kit with RiboErase kit with quality assessed by Agilent High Sensitivity D1000 ScreenTape according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using NEBNext Library Quant Kit and libraries sizes were determined using Bioanalyzer High Sensitivity DNA Kit (Agilent). Indexed libraries were pooled and sequenced on an Illumina MiSeq using a MiSeq Reagent Kit v2 (150×150 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Amplified libraries were cleaned using 1x KAPA Pure Beads Libraries were quantified using NEBNext Library Quant Kit and libraries sizes were determined using Bioanalyzer High Sensitivity DNA Kit (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... Final libraries were QCed using the Qubit dsDNA High Sensitivity kit and Bioanalyzer High Sensitivity DNA Kit (#5067-4627, Agilent). Libraries were sequenced at a concentration of 1.8 pM on a NextSeq with a 75 cycle v2 kit (#TG-160-2002 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library concentrations were measured by Qubit DNA HS kit and the fragment distribution was analyzed by the Bioanalyzer DNA HS kit (Agilent). Before sequencing ...
-
bioRxiv - Genomics 2024Quote: ... The DNA amount was quantified by Qubit HS DNA kit and the fragment size was assessed on a 2100 BioAnalyzer using a DNA HS kit (Agilent). Individual libraries for immunoprecipitated DNA and 10% input were dual indexed (NEBNext Multiplex Oligos ...
-
bioRxiv - Neuroscience 2024Quote: ... The RNA integrity number (RIN) was determined for each sample using Bioanalyzer RNA 6000 Nano Kit or Bioanalyzer RNA 6000 Pico Kit (Agilent) (RIN 8.83 ± 0.93 (mean ± s.d.)) ...
-
bioRxiv - Microbiology 2024Quote: DNA and RNA samples were analysed using either the Tapestation (Tapestation D1000 High Sensitivity DNA kit and Tapestation RNA ScreenTape kit, Agilent) or the Bioanalyzer (DNA 12000 kit ...
-
bioRxiv - Neuroscience 2024Quote: ... a G1603A CE-MS adaptor kit and a G1607A CE-electrospray ionization-mass spectrometry (ESI-MS) sprayer kit (Agilent Technologies). The system was controlled using G2201AA ChemStation software v.B.03.01 for CE (Agilent).
-
bioRxiv - Immunology 2022Quote: ... Quality was measured by capillary electrophoresis using the Fragment Analyzer and the ‘Total RNA Standard Sensitivity Assay’ (Agilent Technologies, Inc. Santa Clara, USA). All samples in this study showed high quality RNA Quality Numbers (RQN > 9.4) ...
-
bioRxiv - Microbiology 2021Quote: ... Fragment size distribution was analyzed on a subset of samples using the Agilent Bioanalyzer 2100 DNA-HS assay (Agilent, Santa Clara, CA, USA). Sample libraries were then normalized and pooled to a concentration of 2 or 0.5 nM based on a predicted total product size of ∼ 420 bp using the Qubit dsDNA HS Assay kit on the Qubit 3.0 fluorometer ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA concentration was measured with Qubit BR RNA Assay and quality and integrity of the RNA was analyzed with the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1000 ng RNA per sample was used for library preparation ...
-
bioRxiv - Microbiology 2021Quote: ... The library fragment length was aimed at fragments with a median size of 575 bases and was assessed with the Genomic DNA ScreenTape assay with the 2200 Tape-Station system (Agilent Technologies, Waldbronn, Germany). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... Medium was changed 1-hour before the start of readout into 180 μL serum-free assay medium (Agilent Seahorse XF DMEM; 103575-100) supplemented with 4mM L-glutamine (Corning ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Size of the libraries and calculation of the final molarity for sequencing was performed with the High Sensitivity D1000 ScreenTape Assay on an Agilent 2200 TapeStation System (Agilent Technologies, Waldbronn, Germany). Average size of the fragments was 181 ± 22 bp ...
-
The transcription factor reservoir and chromatin landscape in activated plasmacytoid dendritic cellsbioRxiv - Molecular Biology 2021Quote: ... and quality measured by capillary electrophoresis using the Fragment Analyzer and the ‘Total RNA Standard Sensitivity Assay’ (Agilent Technologies, Inc. Santa Clara, USA). All samples in this study showed high RNA Quality Numbers (RQN ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then washed 1X with 200 mL warm ATP Assay Medium prepared per protocol (Agilent XF DMEM Medium pH 7.4 (103757-100); 10 mM XF Glucose ...
-
bioRxiv - Microbiology 2022Quote: ... Fragment size distribution was analyzed on a subset of samples using the Agilent Bioanalyzer 2100 DNA-HS assay (Agilent, Santa Clara, CA, USA). Samples libraries were then normalized and pooled to a concentration of 2 nM based on a predicted total product size of 420 base pair (bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the quality as well as yield of fully-barcoded DNA primers was evaluated with total RNA Pico Assay (Agilent Technologies, 5067-1513) and by fluorescent in situ hybridization (FISH ...
-
bioRxiv - Molecular Biology 2024Quote: ... library yields were determined using the Qubit 2.0 DNA HS Assay and the quality of the libraries generated was assessed using the TapeStation HSD1000 ScreenTape (Agilent Technologies Inc., California, USA). The final libraries quantity was assessed by APA SYBR® FAST qPCR with QuantStudio® 5 System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.25 × 105 KCL22 NTC and Ptbp2 KO cells were seeded in each well in 180μl of XF RPMI Assay Medium (Seahorse Bioscience, Cat. #103576–000) supplemented either with 2mM L-glutamine (Cat ...
-
bioRxiv - Immunology 2022Quote: ... and quality measured by capillary electrophoresis using the Fragment Analyzer and the ‘Total RNA Standard Sensitivity Assay’ (Agilent Technologies, Inc. Santa Clara, USA). All samples in this study showed high quality RNA Quality Numbers (RQN ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were performed on an Agilent 1100 series HPLC with a reverse phase column (Agilent Zorbax 300SB-C18, 5 μM, 2.1 × 150 mm). Solvent A was water containing 0.1% TFA and solvent B was acetonitrile containing 0.1% TFA ...
-
bioRxiv - Genomics 2023Quote: ... using a Covaris ME220 ultrasonic shearing system to a median size of ∼300 bp as determined by the Agilent 2100 High Sensitivity Assay (Agilent, Santa Clara, CA). Libraries were generated using the DuplexSeq Rat-50 Mutagenesis Assay library preparation kit and protocol using version 1.0 chemistry as described above ...
-
bioRxiv - Physiology 2023Quote: ... and quality was assessed for a subset of RNA isolates using the Bioanalyzer RNA 6000 Pico Chip assay (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2023Quote: ... Each sample was sized by the Gel fragment analyzer instrument using the DNF-474 High Sensitivity NGS assay (Agilent Technologies #DNF-474-0500) to calculate the average fragment size (expected fragment size of ∼600bp ...
-
bioRxiv - Biochemistry 2024Quote: ... Assay plates were generated by plating 2 µL of the deep well stock plates into 384-well assay plates (Thermo Scientific #142761 using the Agilent V11 Bravo). 88 µL of SrEpac cultured in high-nutrient media (5% Sea Water Complete ...
-
bioRxiv - Immunology 2024Quote: ... HER2 CAR-T cells or mock CAR-T cells from the same donor were added at an effector:target cell ratio of 10:1 and measured in a real-time cell analysis assay using the xCELLigence SP system (Agilent, Santa Clara, CA). An electrical current was applied to each co-culture ...
-
bioRxiv - Plant Biology 2020Quote: ... A Bioanalyzer 2100 (Agilent, High Sensitivity DNA Kit) was used for library quality control ...
-
bioRxiv - Cancer Biology 2021Quote: ... and using the High Sensitivity dsDNA kit (Agilent) on the Agilent 2100 Bio-Analyzer ...
-
bioRxiv - Microbiology 2020Quote: ... run using the RNA 6000 Pico Kit (Agilent). To evaluate the extent of remaining buffer and DNA contaminations ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell glycolysis Test Kit (Agilent, 103020), was used for the assay ...
-
bioRxiv - Cell Biology 2020Quote: ... An Agilent 2100 BioAnalyzer and DNA1000 kit (Agilent) were used to quantify amplified cDNA and to control the quality of the libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... PTHrP staining was visualized with diaminobenzidine kit (Dako) and conterstained with Mayer’s hematoxylin ...
-
bioRxiv - Cell Biology 2020Quote: ... using QuikChange site-directed mutagenesis kit (#200515, Agilent). U2OS cells were transfected with the plasmids by electroporation ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Agilent High Sensitivity DNA kit (Agilent) and concentration was determined using QuantiFluor ONE ds DNAsystem on Quantus fluorometer (Promega) ...
-
bioRxiv - Developmental Biology 2020Quote: The SureSelect Exome Enrichment kit V7 (Agilent Technologies) was used to enrich exome sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) was used.
-
bioRxiv - Molecular Biology 2021Quote: ... the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) was used.