Labshake search
Citations for Agilent :
1851 - 1900 of 5601 citations for Rat CD325 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used for all qRT-PCR reactions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The FANCD2 ΔTower construct was generated using a QuikChange Site-Directed Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and fragment size was controlled using 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent). Sequencing was performed in paired-end mode with a S1 and S2 flow cell (100 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... The mutated SV40 enhancer sequences were created with QuickChange site-directed mutagenesis kit (Stratagene) or using InFusion site-directed mutagenesis ...
-
bioRxiv - Microbiology 2024Quote: ... RNAs were analyzed using Agilent RNA 6000 Nano Kit and the Bioanalyzer system (Agilent). Thereby ...
-
bioRxiv - Neuroscience 2022Quote: ... site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with primer set:SMH1607 forward GAAGACCTGAGCCAGAAGGAGGCAAGCGACCTGCTCAACACCCAG and SMH1608 reverse CTGGGTGTTGAGCAGGTCGCTTGCCTCCTTCTGGCTCAGGTCTTC ...
-
bioRxiv - Neuroscience 2022Quote: ... The concentration of extracted RNA was determined using a NanoRNA kit (Agilent #5067-1511) and Bioanalyzer (Agilent 2100 ...
-
bioRxiv - Microbiology 2022Quote: Mutations in virB2 were introduced using QuikChange II site-directed mutagenesis kit (Agilent Technologies). Plasmid pAD1891 DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were subjected to analysis using XF Cell Mito Stress Test Kit (Seahorse Bioscience), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quality was evaluated using the Agilent DNA 1000 kit (Agilent, Cat# 5067-1504) on the Agilent Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2024Quote: The smcR mutant alleles were created using GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) as per the company protocol targeting the smcR gene encoded on plasmid pJN22 ...
-
bioRxiv - Cell Biology 2024Quote: ... The staining was performed with the Dako LSAB2 System-HRP kit (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library size distributions were confirmed using the High Sensitivity DNA Kit (Agilent #5067-4626) on an Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Systems Biology 2024Quote: ... Both mutations were made using the QuikChange Lightening Site directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions and the sequences were confirmed by DNA sequencing at the Department of Biochemistry (University of Cambridge ...
-
bioRxiv - Systems Biology 2024Quote: ... The quality was checked using RNA 6000 Pico Kit using Agilent 2100 Bioanalyzer (Agilent). Paired-end ...
-
bioRxiv - Neuroscience 2024Quote: ... Southern blot probes were radiolabeled using the Prime-it Random Primer Labeling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Site-directed mutagenesis to generate shfP mutants was achieved using the QuikChange kit (Agilent). All plasmids were integrated into the B ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked for quality with Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany). Only RNA samples with RNA integrity number (RIN ...
-
bioRxiv - Immunology 2024Quote: ... Library QC was performed using the BioAnalyzer High Sensitivity DNA Kit (Agilent, #5067-4626) and run on the 2100 BioAnalyzer Instrument ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA quality was assessed using the RNA 6000 Nano kit total RNA assay (Agilent) run on the 2100 Bioanalyzer instrument (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... site directed mutagenesis was used (QuikChange II XL Site Directed Mutagenesis Kit, Agilent, 200521) as directed ...
-
bioRxiv - Immunology 2024Quote: Extracellular flux assay was performed using Seahorse XF Cell Mito Stress Test Kit (Agilent). 24 hours prior to the assay ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library concentrations were quantified using the Agilent High Sensitivity DNA kit (Agilent Technologies, USA). An equimolar pool consisting of 24 samples was prepared and sequenced on an NextSeq550 (single-read ...
-
bioRxiv - Immunology 2024Quote: ... C188Y and Y64C) were obtained by site-directed mutagenesis (Quick change kit, Agilent Technologies). The *192C*24 and K183S/K184S/*192C*24 plasmids were produced by ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... Site-directed mutagenesis was performed using the QuikChange II Site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... RNA integrity was confirmed using a Bioanalyzer with the RNA 6000 Nano Kit (Agilent). Two sample replicates (one P1 and one P13 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Error-prone PCR was performed using the GeneMorph II EZClone Domain Mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Library size distribution and concentration were measured using BioAnalyzer High Sensitivity DNA kit (Agilent) and NEB quantification kit ...
-
Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of persistent painbioRxiv - Neuroscience 2022Quote: ... and a quality check using a bioanalyzer (Agilent High Sensitivity DNA Kit, #5067-4626). A small aliquot of the amplified cDNA was used for a qPCR testing while the remaining cDNA was kept at -20°C until further processing.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The DNA quality was confirmed by Bioanalyzer high sensitivity DNA kit (Agilent, Santa Clara). Sheared DNA was then adapter-ligated (AL ...
-
bioRxiv - Pathology 2023Quote: ... the reactions were detected/visualized using Envision FLEX+ High pH kit (Dako, GV800+ GV821) and Envision DAB+ Substrate Chromogen System (Dako ...
-
bioRxiv - Systems Biology 2022Quote: ... Library size distributions were determined using the High Sensitivity DNA Kit (Agilent #5067-4626), and sample concentrations were quantified using the Qubit dsDNA HS Assay Kit on a Qubit 4 Fluorometer ...
-
bioRxiv - Immunology 2023Quote: ... RNA concentration and integrity was determined by Bioanalyzer using RNA 6000 Pico Kit (Agilent). RNA-seq libraries were constructed using Illumina TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... on a 2100 BioAnalyzer with an Agilent RNA 6000 Pico Kit (#5067-1513, Agilent), DV200 ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: ... The RNA quality was examined using the Bioanalyzer RNA 6000 pico kit (Agilent, USA).
-
bioRxiv - Microbiology 2022Quote: ... sgRNA quality control was performed on Qubit and Bioanalyzer RNA 6000 Pico Kit (Agilent).
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA synthesis was performed using Accuscript High-fidelity cDNA Synthesis Kit (Agilent technologies, USA) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies). High-quality amplified RNAs were subject to library preparation (Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies, Cat. 103015-100) and following the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... Phosphorylation mutants were created using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies). All mutant constructs were verified by Sanger sequencing.
-
bioRxiv - Genetics 2023Quote: ... RNA quality was assessed with the Agilent RNA 6000 Nano Kit (Agilent 5067-1511) run on an Agilent 2100 Bioanalyzer instrument ...
-
bioRxiv - Genetics 2023Quote: ... Library quality was assessed with the Agilent High Sensitivity DNA Kit (Agilent 5067-4626) run on the Agilent 2100 Bioanalyzer instrument or submitted to the JH SCTC for processing on an Agilent Fragment Analyzer ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µM Antimycin A + Rotenone (Seahorse XF Cell Mito Stress Test Kit, Agilent) was added sequentially via injection ports ...
-
bioRxiv - Biophysics 2023Quote: Human FKBP12.6 cDNA was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of eight single cysteine mutants (G1C ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA integrity was analysed using the NanoChip (Agilent RNA 6000 Nano kit, 5067-1511) and 1 µg of RNA was prepared in water to a final volume of 50 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... and integrity was tested before use using an Agilent RNA 6000 Nano Kit (Agilent) on an Agilent 2100 Bioanalyzer.
-
bioRxiv - Molecular Biology 2023Quote: All mutations in PSENEN were generated with the XL site-directed-mutagenesis kit (Stratagene) and confirmed by DNA sequence analysis ...
-
bioRxiv - Physiology 2023Quote: ... Isolated mRNA was then reverse transcribed using the AffinityScript qPCR cDNA Synthesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis was performed with the QuikChange II Site-directed Mutagenesis kit (Agilent) and primers ML 4421/4422 to generate the TOPO-DrpAK42A vector ...