Labshake search
Citations for Agilent :
1801 - 1850 of 6801 citations for Progesterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further three times with TBS-T for 5 minutes and stained with DAKO EnVision-HRP rabbit/mouse (Agilent; #K5007) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS, Agilent Technologies, Palo Alto, USA) via a heated transfer line (300 °C) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was additionally purified with ZymoResearch DNA Clean & Concentrator-5 columns (D4003T) and digested DNA profiles confirmed using the 2100 Bioanalyzer with the Agilent DNA High Sensitivity chip (Agilent Technologies). The libraries were then prepared using the Qiaseq Ultra Low Input Library Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Chromatography was carried out using a Zorbax SB C18 column (150 × 2.1 mm, 5 µm, Zorbax, Agilent, Santa Clara, CA, USA) which was proceeded with a SB-C18 Guard Cartridges (12.5 × 2.1 mm ...
-
bioRxiv - Genetics 2023Quote: ... we inserted a wild-type histone array sequence containing the 5 replication-dependent histone genes into a pBluescript II KS+ vector (Agilent #212207) and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... muropeptide originating from peptidoglycan extracted from the same number of cells (1.5×109) were analyzed by reverse phase-ultra high-pressure liquid chromatography (RP-UHPLC) using a 1290 chromatography system (Agilent Technologies) equipped with a Zorbax Eclipse Plus C18 RRHD column (100×2.1 mm ...
-
bioRxiv - Cell Biology 2023Quote: ... Sections were washed three times for 5 min each in TBST and mouted with flourescence mounting medium (Dako, Santa Clara, USA). Images of immunofluorescence secitons were captured by confocal microcopy FV1000 (Olympus ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Biophysics 2024Quote: ... The plate was gently shaken to mix the well contents and the absorbance at 595nm was measured with a Biotek Cytation 5 Microplate Reader (Agilent, USA). The absorbances of the diluted samples were used to form dilution curves and the slopes of the linear regions of each curve were compared to determine the necessary dilution factors for each lysate that would allow the curves to overlap ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Bioengineering 2024Quote: ... The pellets from centrifugation were dried under vacuum and re-dissolved using 5% acetic acid aqueous solution for purification by HPLC (1260 Infinity, Agilent Technologies) equipped with a C8 column (Zorbax 300SB-C8 ...
-
bioRxiv - Cell Biology 2024Quote: ... Following the 24 min gradient the analytical column was backflushed for 6 min with 99% acetonitrile at a 0.8 ml/min flow rate followed by a 5 min re-equilibration step (MassHunter Metabolomics dMRM Database and Method, Agilent Technologies). Data analysis was performed with MassHunter Quantitative Analysis (v ...
-
bioRxiv - Biochemistry 2024Quote: ... Tryptic peptides were separated with a microfluidic reversed-phase HPLC chip (ZORBAX 300SB-C18; particle size, 5 μm; inner diameter, 75 μm; and length, 43 mm; Agilent Technologies). Samples were loaded using 0.1% formic acid and 5% acetonitrile in water as a mobile phase at flow rate of 4 μl/min ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative real-time PCR was performed using a QuantStudio™ 5 Real-Time PCR System with Brilliant II low ROX Sybr Green (Agilent). Reactions were performed with at least 2 technical replicates and 3 biological replicates were performed for each experiment ...
-
bioRxiv - Plant Biology 2024Quote: ... according to the manufacturer’s instructions with the following changes: RNA was fragmented 5’ and the protocols were automated using an Agilent NGS workstation (Agilent Technologies) with purification steps described by Lundin et al ...
-
bioRxiv - Bioengineering 2021Quote: ... The electrical characteristics of the brain phantom were determined with a VNA equipped with a dielectric probe kit (85070E kit, Agilent Technologies, Santa Clara, CA) and were representative of the averaged human brain (er = 66.34 and σ = 0.49 S m−1) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed using an Agilent RNA Nano kit on a BioAnalyzer instrument (RNA 6000 Nano Kit, Agilent, Santa Clara, CA, United States). Libraries were subsequently prepared and sequenced at Psomagen ...
-
bioRxiv - Genomics 2024Quote: ... RNA quality was assessed using an Agilent 2100 Bioanalyzer with an RNA 6000 Nano Kit or RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA). ERCC ExFold RNA Spike-In Mixes (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... and examined with the 2100 Bioanalyzer (RNA6000 Pico Kit, Agilent, cat.no ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quick Change XL Site-Directed Mutagenesis Kit (200516, Agilent Technologies) was used to construct ZHX2 mutants ...
-
bioRxiv - Cancer Biology 2021Quote: ... and High Sensitivity DNA Kit (Agilent Technologies, Cat # 5067-4626). Generated DNA fragments were quantified with Qubit dsDNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... capillary electrophoresis instrument and the CRISPR Discovery Gel Kit (Agilent). To verify that the E-box was successfully replaced by the LexO site ...
-
bioRxiv - Cell Biology 2020Quote: ... Both vectors were edited using the QuickChange® kit (Stratagene) to generate constructs encoding PICK1 coding variants ...
-
bioRxiv - Genetics 2021Quote: Site-directed mutagenesis was performed with QuikChange II kit (Agilent), using manufacturer recommended procedures.
-
bioRxiv - Developmental Biology 2021Quote: ... Quality was confirmed using Agilent RNA 6000 Nano kit (Agilent) on the 2100 Bioanalyzer Instrument (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were prepared by SureSelectXT Library Prep Kit (Agilent), hybridized to the appropriate capture panel ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sheared by the Sure Select Enzymatic Fragmentation kit (Agilent Technologies Inc. ...
-
bioRxiv - Physiology 2022Quote: ... using an Agilent High Sensitivity DNA Kit (Agilent Technologies, France). Libraries were prepared from 0.15 ng cDNA using the Nextera XT Illumina library preparation kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... the QuickChange Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to introduce the above mutations into the constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Quikchange 2 Site-Directed Mutagenesis Kit (Agilent Technologies 210518) was used to introduce the two mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... XFe96 extracellular flux assay kit probes (Seahorse Bioscience 102601-100) were incubated with the included calibration solution overnight at 37°C under non-CO2-injected conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA content was measured with a Bioanalyzer pico kit (Agilent). 1% RNA SIRVs were spiked-in (Lexogen) ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... using an Agilent High Sensitivity DNA Kit (Agilent Technologies, France). Libraries were prepared from 0.15 ng cDNA using the Nextera XT Illumina library preparation kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Qualifying samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Genomics 2020Quote: ... We acquired plasmid pTXB1-Tn5 from Addgene and used the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) and the Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and quality checked with Bioanalyzer DNA High Sensitivity Kit (Agilent).
-
bioRxiv - Plant Biology 2019Quote: ... and a Bioanalyzer DNA12000 kit (Agilent, Santa Clara, CA, USA). Twelve µg of non-sheared DNA were used to prepare the SMRTbell library ...
-
bioRxiv - Molecular Biology 2019Quote: ... and analyzed with 2100 Bioanalyzer with DNA 1000 kit (Agilent). Libraries were sequenced on HiSeq 1500 (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... and analyzed with 2100 Bioanalyzer with DNA 1000 kit (Agilent). Libraries were sequenced on HiSeq 1500 (Illumina ...
-
bioRxiv - Physiology 2020Quote: ... and Seahorse XF Mito Stress Test Kit (Agilent, 103015-100). 4 × 104 cells were plated into each well prior to the assay ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were introduced using the QuickChange Mutagenesis Kit (Agilent).
-
bioRxiv - Biophysics 2019Quote: ... was performed using the QuikChange kit (Agilent; Santa Clara, CA) or by subcloning synthetic oligonucleotides (Sigma ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The mRNA was assessed using the RNA Pico kit (Agilent) and used to make transcriptome libraries using the PrepX RNA-Seq for Illumina Library Kit (Takara) ...