Labshake search
Citations for Agilent :
1801 - 1850 of 4126 citations for 7 Quinolinamine 1 2 3 4 tetrahydro 1 methyl hydrochloride 1 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... cDNA library size was checked using Fragment Analyzer HS NGS Fragment Kit (1-6000bp) (Agilent formerly Advanced Analytical ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCNA was stained by the use of mouse monoclonal anti-PCNA antibody (1:50; Dako) followed by the use of an ABC M.O.M ...
-
bioRxiv - Biochemistry 2022Quote: ... AR (1:100) (Cat. No. sc-7305; Santa; Host species: Mouse) were diluted by Dako Antibody Diluent ...
-
bioRxiv - Cell Biology 2022Quote: ... Goat Anti-Rabbit Immunoglobulins/HRP (dilution 1:100,000, #P0448, Dako Denmark A/S, Glostrup, Denmark) for 1h in RT ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal antibody against Ki-67 (dilution 1:50; Code No. M7249, Dako, Glostrup, Denmark) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... α (1–2,3,4,6) fucosidase and Sialidase A (all enzymes were purchased from Glyko/ProZyme, Inc.) in 100 mM ammonium acetated buffer (pH = 5.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated for 1 h at 37 °C with blocking buffer (Agilent Technologies, Waldbronn, Germany). Afterwards ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 1:4000 dilution of anti-mouse HRP-conjugated secondary antibody into blocking milk (DAKO) was applied to the membrane for 1h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by incubation with polyclonal goat anti-rabbit IgG/HRP antibody (1:1000; DAKO Cytomation) for 90 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or a DB-VRX capillary column (20 m, 0.18 mm ID, 1 μm film; Agilent); (ii ...
-
bioRxiv - Cell Biology 2023Quote: ... Tissue sections were blocked for 1 h at RT with protein blocking solution (#X0909, Dako). After blocking ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse and/or rabbit IgG (1:1000, 1μg/mL, diluted in antibody diluent, Agilent Technologies) served as negative control ...
-
bioRxiv - Zoology 2023Quote: ... 1 µL of the derivatized samples were analyzed using a 7890B GC System (Agilent Technologies), and 5973 Network Mass Selective Detector (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... Secreted proteins were captured by addition of 100:1 (v/v) secretome:Strataclean resin (Agilent Technologies) (∼2 ml ...
-
bioRxiv - Cell Biology 2023Quote: ... horse-radish peroxidase (HRP) conjugated secondary antibodies were used in 1:2500 (anti-rabbit, DAKO) or in 1:10.000 (anti-mouse ...
-
Cell cycle plasticity underlies fractional resistance to palbociclib in ER+/HER2- breast tumor cellsbioRxiv - Cancer Biology 2023Quote: ... Ki-67 was scored according to the Ki-67 IHC MIB-1 pharmDx (Dako Omnis) Interpretation Manual for Breast Carcinoma ...
-
bioRxiv - Biochemistry 2023Quote: ... The TEV eluates were incubated for 1 h with prewashed calmodulin sepharose beads (Agilent Technologies) and washed with lysis buffer containing 2 mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl of each sample was run on a 2100 Bioanalyzer (Agilent Technologies, CA, USA) with an Agilent DNA 1000 chip (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... using a high-sensitivity NGS Fragment Kit (1-6000bp) (Agilent, catalog no. DNF-474-0500). Sequencing libraries were loaded on an Illumina NovaSeq6000 with PE 2 x 50 paired-end kits by using the following read length ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA concentration and integrity were determined using 1 µl in 4150 TapeStation System (Agilent). The rest of the sample was immediately frozen at -80°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Staining of the brains was performed in groups consisting of GFAP (DAKO rabbit 1:500) and tomato lectin (Vector Labs mouse 1:250) ...
-
bioRxiv - Plant Biology 2023Quote: ... allowing a sub-sample (∼1 μg) into the pyrolizer of the GC/MS apparatus (Agilent, 7890A/5975C ...
-
bioRxiv - Genomics 2022Quote: ... Nucleosome footprints (1:10 dilution) were visualized by Tapestation using High sensitivity D1000 ScreenTape (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were stained with mouse monoclonal anti-CKAE1/AE3 antibody (Dako, M3515, 1:200 dilution), guinea pig polyclonal anti-doublecortin antibody (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... A horseradish peroxidase-conjugated polyclonal Goat Anti-Rabbit antibody (50µl, 1:2000; P0448, Dako; RRID:AB_2617138) was added in each well for 1.5 hours at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... an astrocytic marker (1:100, clone 6F2, Dako/Agilent, cat#M0761, Santa Clara, CA, USA), and MAP2 ...
-
bioRxiv - Plant Biology 2023Quote: ... or 1:1000 in nanopure water) were filtered through a 0.2 mm syringe filter (Agilent Captiva Econo Filter ...
-
bioRxiv - Systems Biology 2024Quote: ... VA) or glial fibrillar acidic protein (GFAP; 1:1000; G3893-100uL; Dako, Santa Clara, CA). For Iba1 staining ...
-
bioRxiv - Cell Biology 2024Quote: ... PAECs were immunolabelled using primary mouse monoclonal antibodies against CD31 (1:25; clone JC70A; Dako) and vWF (1:50 ...
-
bioRxiv - Physiology 2024Quote: ... Organoids were stained with the anti-lysozyme antibody for imaging diluted 1:1000 (Dako, #A0099) and visualized with goat antirabbit Alexa fluor 568 (Invitrogen #A-11036) ...
-
bioRxiv - Neuroscience 2024Quote: ... GFAP (astrocytic marker, 1:100, clone 6F2, Dako/Agilent, cat#M0761, Santa Clara, CA, USA), vimentin (1:100 ...
-
bioRxiv - Microbiology 2024Quote: RNA quality and integrity was inspected in 1% agarose gels and a 2100 Bioanalyzer (Agilent). rRNA depletion ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 299.294 m/z (Methyl Stearate; Agilent article number G1982-85003) were used to recalibrate spectra during the acquisition.
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µg of plasmid ASAP3 and ASAP3-R3 were added into the solution of GeneJammer (Agilent) transfection reagent in Opti-MEM (3 µL in 200 µL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The secondary antibodies were horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:5000, Dako, Japan) and HRP goat anti-rat IgG antibody (Biolegend ...
-
bioRxiv - Microbiology 2019Quote: ... This was followed by incubation with the primary antibody (diluted 1:1,000 in dilution buffer; Dako) for 60 min at room temperature (RT) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were permeabilized using 0.2% Triton X-100 (Fisher) in 1:10 dilution Blocking Buffer (Dako) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... of which 1 μl was examines on a Bioanalyser high sensitivity DNA chip (Agilent 5067-4626). Ideal cycle number should bring final library to final concentration of 1-3 nM ...
-
bioRxiv - Molecular Biology 2021Quote: ... of which 1 μl was examined on a Bioanalyser high sensitivity DNA chip (Agilent 5067-4626). Ideal cycle number should bring final library to final concentration of 1-3 nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... US Biological Life Sciences) and secondary antibody Rabbit Anti-Goat Ig/HRP (1:5,000, #P0160, Dako). Immunoblotting for α-Tubulin was performed using polyclonal Rabbit Anti-α-Tubulin antiserum as primary antibody (1:4,000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies and dilutions used are as follows: guinea pig anti-insulin (DAKO, A0564, 1:1000), mouse anti-glucagon (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-PALB2 full-length and fragments were purified from 1 L of ArcticExpress cells (Agilent Technologies), grown at 37°C in LB broth medium containing 50 µg/mL ampicillin and 25 µg/mL gentamycin ...
-
bioRxiv - Neuroscience 2019Quote: ... The Western blot was stained with DAKO-Tau (1:10 000, Dako/Agilent, cat no A0024), while the second gel was stained with Colloidal Coomassie Staining solution (0.1% Coomassie Blue G250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The Western blot was stained with DAKO-Tau (1:10 000, Dako/Agilent, cat no A0024), while the second gel was stained with Colloidal Coomassie Staining solution (0.1% Coomassie Blue G250 ...