Labshake search
Citations for Agilent :
1801 - 1850 of 3968 citations for 6 BROMO 4 4 DIETHYL 1H BENZO D 1 3 OXAZINE 2 4H THIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Evolutionary Biology 2023Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... vector containing the SARS-CoV-2 HA-ORF3a gene was used in site-directed mutagenesis using a QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Genomics 2021Quote: ... Floating sections were permeabilized, blocked, probed by Iba-1 antibody (Wako, catalog # 019-19741, and 1:800 dilution) or GFAP antibody (DAKO, catalog # z0334, and 1:500 dilution), inactivated endogenous peroxidases ...
-
bioRxiv - Neuroscience 2022Quote: ... 29] for astrocytes (rabbit anti-GFAP 1:500, Dako, mouse anti-α-tubulin 1:500, Sigma) and microglia (rabbit anti-Iba1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2,000, Agilent Dako, P0448 polyclonal goat anti-rabbit immunoglobulins, RRID:AB_2617138; 1:4,000, Agilent Dako ...
-
bioRxiv - Neuroscience 2023Quote: ... Appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2,000, Agilent Dako, P0448 polyclonal goat anti-rabbit immunoglobulins, RRID:AB_2617138; 1:4,000, Agilent Dako, P0447 polyclonal goat anti-mouse immunoglobulins ...
-
bioRxiv - Neuroscience 2023Quote: ... Tween 20 0.05%) and 1 hour incubation with HRP-conjugated secondary antibody (1:1,500, Dako, #P0260) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-Fibronectin (Dako, 1:1000) in Block solution (4% BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-S100β (1:400, Dako), mouse anti-GS (Glutamin Synthetase ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-PCNA (Dako #M0879, 1:1000), anti-GFP (Abcam #ab13970 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Anti-GFAP (Dako, Z0334, 1:250), Anti-FOXP2 (Abcam ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-DESMIN (1:200; Dako), rat anti-F4/80 (1:200 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Pfu buffer (Agilent), 0.1 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... and MPO (1:500, A0398, Dako) were used ...
-
bioRxiv - Developmental Biology 2019Quote: ... or mouse (Dako, M7240, 1:50) anti-Ki67 monoclonal antibody ...
-
bioRxiv - Neuroscience 2019Quote: ... ubiquitin (DAKO, 1:250, basic AR), ubiquilin 2 (Novus Biologicals ...
-
bioRxiv - Neuroscience 2019Quote: ... Pgp9.5 (1:200 dilution; Dako # Z5116) marking for nerve fibers ...
-
bioRxiv - Cell Biology 2019Quote: ... (1:400, rabbit polyclonal, Z0097, Dako) to delineate muscle fibre architecture ...
-
bioRxiv - Genomics 2020Quote: ... CD8 (1:100, C8/144B, Dako), CD68 (1:100 ...
-
bioRxiv - Immunology 2021Quote: ... or SMA (Dako #M0851, 1:200). Secondary detection was with DAKO Envision HRP reagents or anti-species fluorophore conjugates (Thermofisher) ...
-
bioRxiv - Immunology 2020Quote: ... and 1 µM antimycin A (Agilent). Cells were stimulated with 1 µg/µL of anti-CD3 and 5 ng/mL IL-2 15 minutes prior to each metabolic test ...
-
bioRxiv - Neuroscience 2020Quote: ... goat or rabbit (1:300, Dako) was used ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-GFAP (Dako, 1:1500), and mouse anti-PMY (Kerafast ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-GFAP (1:1000, DAkoCytomation), rabbit anti-Iba1 (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-MPO (1:500; Dako; A0398). For nuclear staining ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-ubiquitin (1:2000; rabbit; Dako), anti-orexin (1:4000 ...
-
bioRxiv - Biochemistry 2020Quote: ... and α(1–2,3,6) mannosidase (Prozyme). All exoglycosidase digests were carried out at 37 °C and at the reaction conditions recommended by the respective enzyme supplier ...
-
bioRxiv - Microbiology 2020Quote: ... pylori (1:250) was from Dako, Denmark and mouse monoclonal anti-H ...
-
bioRxiv - Systems Biology 2020Quote: ... rabbit anti-GFAP (1:300, DAKO); mouse anti-PCNA (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse (goat, Dako, 1:2000), anti-rat (rabbit ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-S100β (1:1k, DAKO), goat anti-Sox9 (1:1000 R&D) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-GFAP (1:2000, Z0334, DAKO) or anti-Iba1 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-GFAP (1:1000; Agilent), mouse anti-Tuj1(1:100-1000 ...