Labshake search
Citations for Agilent :
1701 - 1750 of 4080 citations for 1 4 Bis acetyloxy 3 dodecylsulfanyl 2 naphthyl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... viral protein in the virus-infected cells was detected by ELISA assay using anti-SARS-CoV-2 nucleocapsid mAb (40143-R001, SinoBiological) and HRP-conjugated goat anti-rabbit pAb (P0448, Dako). After 10 min incubation with TMB substrate ...
-
bioRxiv - Immunology 2022Quote: ... The negative control used was the Rabbit FLEX Universal Negative Control (cat. no. IR60066-2, Agilent, Santa Clara, CA, USA). Images were scanned using the Brightfield setting of the Vectra Polaris Multispectral Imaging System.
-
bioRxiv - Genomics 2022Quote: ... Arrays were read using an Agilent scanner at 2 μm resolution and the signal segmentation was done using the feature extraction software (Agilent). The data was normalized without background subtraction using the global Lowess method (74).
-
bioRxiv - Neuroscience 2022Quote: ... Then 25 μl of the supernatant was transferred into a 2 ml sample vial containing a 250 μl deactivated glass insert (5181-8872, Agilent). 40 μl of N-Methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA ...
-
bioRxiv - Cell Biology 2022Quote: ... yeast cells were preinoculated in selective medium and the next day an OD600 of 0.01 was inoculated in YNB medium and growth was monitored every 2 h in spectrophotometer (Cary 60 UV-Vis, Agilent). Yeast cells were transformed using a standard lithium acetate transformation protocol (Gietz and Woods ...
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... OCR and ECAR was determined in standard Seahorse medium on day three after seeding before and after injection of 2 µM oligomycin on a XF24 analyzer (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: 100 μL of purified recombinant protein (at approximately 2 mg/mL) were loaded onto a sizeexclusion chromatography column (PL1580-3301, Agilent) in the phosphate buffer (20 mM Tris ...
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Microbiology 2021Quote: ... D950N) were prepared from wild-type SARS-CoV-2 spike using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent). Additional RBD mutations were introduced into the Delta spike also using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... The size of the amplicon was confirmed by analyzing 2 μl of PCR products using the Agilent D5000 ScreenTape System (Agilent D5000 ScreenTape ...
-
bioRxiv - Biochemistry 2021Quote: About 2 µg of obtained total RNA was immediately used for cDNA formation using AccuScript High Fidelity cDNA Synthesis Kit (Agilent). RT-qPCR was performed in a 96-well plate on a CFX96 qPCR system (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were transferred into 2 mL LC/MS glass vials for the LC-MS/MS analysis by using an UHPLC system (Agilent Technologies 1290 with a UPLC BEH Amide column ...
-
bioRxiv - Immunology 2021Quote: ... Epitope retrieval was performed at 97C for 10 min with the Dako Target Retrieval Solution pH 9 (Agilent, S236784-2) on a Lab Vision PT Module (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2021Quote: ... the initial concentrations of purified SARS-CoV-2 and the universal human reference RNA (UHRR, Agilent Technologies, product number 740000) were determined by ddPCR as described above ...
-
bioRxiv - Cell Biology 2021Quote: ... The jordan and shaker-2 non-synonymous substitutions were separately introduced into pFastbac1 M15-2IQ-EGFP-FLAG by site-directed mutagenesis (QuikChange II, Agilent) and verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... cells in a concentration of 2×105 cells/well were transferred into an 8-well plate (Agilent Seahorse XFp miniplate), which was previously coated overnight with poly-L-lysine (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... 50 µL of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2% FBS was added to each well of a 96-well E-plate (Agilent) to establish the background reading ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Isolated genomic DNA was sheared to a mean size distribution of 20 kb using a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and fragment size was confirmed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Microbiology 2022Quote: The tandem mass spectrometer was hyphenated to a liquid chromatography set-up comprising 2 binary pumps (1290 series, Agilent technologies). For each experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... live cell imaging lines were generated using a U-2 OS cell line harboring a Flp-In site and stably expressing a ponasterone A inducible system (Agilent), a gift from Robert Singer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated viral (AAV) vector serotype 2 was prepared using an AAV Helper-Free system (Agilent Technologies, Santa Clara, CA) as described previously (Kato et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the integrity and size distribution of the RNA was assessed using mRNA Nano series 2 assay (G2938, Agilent Technologies).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... SARS-COV-2-Strunc variants were generated in house by site-directed mutagenesis (QuikChange Multi Site-Directed Mutagenesis Kit, Agilent) starting from synthetic DNA (Genscript) ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Microbiology 2023Quote: ... HCT-8 cells or HCT-8 AhR KO cells were plated at 2 x 104 cells per well in a 96-well Seahorse XF96 cell culture microplate (Agilent) and grown for ∼24h ...
-
bioRxiv - Cell Biology 2023Quote: ... was purchased from Jackson ImmunoResearch Laboratories and was used for Western blotting. Affinity-purified rabbit polyclonal anti-human lambda-light chain (cat. A019302-2) was purchased from Dako and was used for Western blotting ...
-
bioRxiv - Microbiology 2023Quote: ... were prepared and stained with hematoxylin eosin (HE) for histological examination or subjected to immunohistological staining to detect SARS-CoV-2 antigen (performed in an autostainer; Agilent), using the horseradish peroxidase (HRP ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... vector containing the SARS-CoV-2 HA-ORF3a gene was used in site-directed mutagenesis using a QuikChange II site-directed mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cell Biology 2024Quote: ... SC/KD-miRNA-transduced MIN6 cells were cultured in 2 mM glucose and treated with a total RNA isolation mini kit (Agilent) and 1st strand synthesis kit (Origine) ...
-
bioRxiv - Microbiology 2024Quote: ... Infection curve analysis was conducted by combining 107 CFU/ml of the clinical isolate selected and 108 PFU/ml of the phage selected in 200 µl of LB broth in a 96 well microplate and incubating for 24 h at 37°C in an Biotek Epoch 2 (Agilent). Productive infection was assumed to have taken place when the OD was significantly lower than the control in the exponential phase.
-
bioRxiv - Microbiology 2024Quote: ... tissues were incubated with primary antibodies overnight (Iba1 (019-19741, FUJIFILM Wako Pure Chemical Corporation) or S100b (GA50461-2, Agilent)) ...
-
bioRxiv - Bioengineering 2024Quote: ... The final co-cultures were then incubated at 37°C in an automated spectrophotometer (Biotek Synergy 2, Agilent Technologies, USA) for 48 hours ...
-
bioRxiv - Genomics 2024Quote: ... The high-molecular weight DNA sample was then sheared to a mean size of 20 kb with a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and the subsequent size distribution was assessed with an Agilent Fragment Analyzer (Agilent Technologies ...