Labshake search
Citations for Agilent :
1651 - 1700 of 5601 citations for Rat CD178 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... DNA quality was assessed with the TapeStation genomic DNA kit (Agilent, #5067-5365). Samples too diluted to be compatible with the kit were first concentrated using AMPure Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and H1N1pdm09 were generated using the QuikChange II site-directed mutagenesis kit (Agilent). The PR8 pHW-PA(ΔX ...
-
bioRxiv - Molecular Biology 2024Quote: Isolated RNA was examined on a Bioanalyzer with the RNA Nano kit (Agilent). RNA-Seq library preparation was carried out with 1 µg of RNA from all samples that passed an RNA Integrity Number (RIN ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 7 using the Agilent SureSelect Kit (Agilent Technologies, Santa Clara, CA, USA). Whole-genome sequencing was carried out for the proband of Pedigree 5 using the DNBSEQ-T7 platform (Huada ...
-
bioRxiv - Cell Biology 2024Quote: JOSD1 C36A mutant was generated using QuickChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara ...
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent, catalog number 600559). All procedures were performed following the manufacturer’s protocols ...
-
bioRxiv - Genetics 2024Quote: Total RNA was isolated with Absolutely RNA Miniprep Kit (Agilent, catalog number 400800). cDNA was synthesized with AffinityScript QPCR cDNA Synthesis Kit (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... following the instructions of the manufacturer (Agilent RNA 6000 Pico Kit 5067–1513). Amplification of the extracted RNA (700 pg ...
-
bioRxiv - Neuroscience 2024Quote: ... and High Sensitivity NGS fragment analysis kit on the Fragment Analyzer (Agilent Technologies). The amount of cDNA was standardized across samples and the libraries were sequenced on Illumina NextSeq500 sequencing machine with 75-bp single-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: Site-directed mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was quantified on an Agilent BioAnalyzer via the Pico kit (Agilent). SMART-Seq HT Kit (Takara ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was generated using AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Stratagene). The Mus musculus IGHV1-72*01 allele (IMGT accession number J00530:206-499) ...
-
bioRxiv - Bioengineering 2020Quote: ... RNA isolation and reverse transcription were performed using the Absolutely RNA Miniprep kit (Stratagene) and cDNA synthesis system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibody was pretreated with a biotinylation reagent (Animal Research Kit, DAKO, Denmark) for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... avidin-biotin blockade was performed using the avidin-biotin blocking kit (DAKO, Glostrup, Denmark). To eliminate nonspecific protein interactions with the primary antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was amplified and labeled using the low RNA input linear amplification kit (Agilent). Labeled cDNA was hybridized onto Affymetrix Human Gene 2.0-ST array ...
-
bioRxiv - Developmental Biology 2020Quote: ... amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies). RNA-seq libraries were constructed using Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... all DNA libraries were checked with Agilent BioAnalyzer High Sensitivity DNA Analysis Kit (Agilent). DNA concentration was measured both by Qubit dsDNA HS assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and assessed using the Seahorse XF real-time ATP rate assay kit (Agilent Technologies) on a Seahorse XFe96 extracellular flux analyzer (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... Molecular mutants were prepared using the QuikChange II XL site-directed mutagenesis kit (Stratagene). The mCherry plasmid was previously described(Pauker ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mutagenesis of the Serine345 codon of Kcnk5b was performed using QuikChange Mutagenesis kit (Agilent).
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Quality was determined on a 2100 Bioanalyzer using the RNA 6000 Nano Kit (Agilent). Concentration was determined using a Nanodrop 8000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... primer P3 (Table S2) was used in the QuikChange Multisite-directed mutagenesis kit (Agilent), and the resulting plasmid was transformed into XL10 Gold ultracompetent Escherichia coli cells ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA-Seq libraries were prepared using the SureSelect Strand-Specific RNA-Seq Kit (Agilent), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cluster optimization were performed using the QPCR NGS Library Quantization Kit (Agilent Technologies). RNA-seq libraries were pooled (4-plex ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was harvested and quantified with the Bioanalyzer DNA High-Sensitivity kit (Agilent Technologies). Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality and quantity was assessed using Agilent High Sensitivity DNA kit (Agilent Technologies) and Qubit dsDNA HS assay kit (Thermo Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... RNA quality was assessed using a Bioanalyzer 2100 with RNA 6000 Nano kit (Agilent). 500ng of total RNA or mRNA for each sample were then digested to single nucleosides as previously described (Courtney et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 µg amplified cDNA was Cy5-labeled using the SureTag DNA labeling kit (Agilent). Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome ...
-
bioRxiv - Genomics 2020Quote: ... Quantification of the library was performed using the Agilent DNA 1000 Kit (Agilent Technologies). Sequencing was performed following the manufacturer’s protocol on the Illumina MiSeq system (Illumina ...
-
bioRxiv - Genomics 2019Quote: RNA quality and quantity were checked by Agilent 2100 Bioanalyzer with the RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA). mRNA was isolated from total RNA using the MICROBExpress kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... and N101A were generated by site directed mutagenesis using the QuickChange Lightning kit (Agilent). hCD11bNb1 ...
-
bioRxiv - Genomics 2020Quote: ... The correct fragment size was confirmed with a High Sensitivity Bioanalyzer DNA Kit (Agilent). Sequencing was performed on an Illumina NextSeq 550 system with a High-Output Kit (75 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... Site-directed mutants were constructed using the Quikchange site-directed mutagenesis kit (Agilent Technologies). The sequences of all plasmid constructs were verified by both forward and reverse sequencing (Sangon Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... were constructed using a QuikChange site-directed mutagenesis kit (Stratagene, San Diego, CA, 200514). The green fluorescent protein (GFP ...
-
bioRxiv - Cell Biology 2019Quote: ... Site directed mutagenesis for CA14 (Thr199Ile) was carried out using SDM II kit (Agilent) using primers listed in Supplementary table 1 ...
-
bioRxiv - Cancer Biology 2020Quote: The one-color microarray Human miRNA Microarray Kit (V2) design ID 029297 from Agilent Technologies was used to measure miRNA expression for 425 tumors of the Oslo2 cohort using 100 ng total RNA as input ...
-
bioRxiv - Systems Biology 2020Quote: ... and the Agilent Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent, Santa Clara, CA). Though we used a 1x ratio of AMPure beads for the libraries presented here ...
-
bioRxiv - Systems Biology 2020Quote: ... and quality assessed using the Agilent Bioanalyzer with the DNA high sensitivity kit (Agilent). End-repair was performed using the NEBNext End Repair Module (E6050S ...
-
bioRxiv - Genomics 2019Quote: ... RNA qualification and quantification using Bioanalyzer RNA Nano 6000 Kit was purchased from Agilent, and RNA quantification using Qubit RNA HS Assay Kit was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Mitochondrial respiration function was measured using Seahorse XF Cell Mito Stress Test kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... Site directed mutagenesis was performed using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) to generate a construct resistant to interference by shSULT4A1 (indicated as SULT4A1r or SULTr) ...
-
bioRxiv - Cell Biology 2019Quote: ... Sample integrity was tested on an Agilent Bioanalyzer 2100 RNA 6000 Nano kit (Agilent). RNA samples with a RNA Integrity Number > 8 were used for library preparation using the protocol for the TruSeq Stranded mRNA library kit (Illumina ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The quality of the total RNA was assessed using the RNA Nano kit (Agilent). Poly-A selection was conducted on the total RNA using PrepX PolyA mRNA Isolation Kit (Takara) ...
-
Structural determinants of protocadherin-15 elasticity and function in inner-ear mechanotransductionbioRxiv - Biophysics 2019Quote: ... mutation p.V250N was introduced in EC1-4 using the QuikChange Lightning mutagenesis kit (Agilent), and all constructs were sequence verified ...
-
bioRxiv - Microbiology 2019Quote: ... The total RNA quality was checked using the RNA 6000 Nano kit from Agilent Bioanalyzer ...
-
Transcriptomic and morphological response of SIM-A9 mouse microglia to carbon nanotube neuro-sensorsbioRxiv - Bioengineering 2020Quote: ... RNA quality was checked using the 2100 Bioanalyzer with RNA 6000 Nano Kit (Agilent). RIN scores were confirmed to be >7 prior to library preparation.
-
bioRxiv - Microbiology 2021Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer RNA Kit (Agilent), respectively ...