Labshake search
Citations for Agilent :
1601 - 1650 of 1828 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The quality of nucleic acids was assessed with a Fragment Analyzer (Agilent, Switzerland) at the Lausanne Genomic Technologies Facility of the University of Lausanne.
-
bioRxiv - Molecular Biology 2022Quote: ... and 2.5 µM medronic acid (5191-4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Neuroscience 2021Quote: ... + rabbit anti-GFAP (1:500 dilutio L gilent Dako cat. no. Z0334), or mouse anti-GFAP (1:500 dilution ...
-
bioRxiv - Biochemistry 2023Quote: ... The mass spectrometer was calibrated with tuning mix (ESI-L, Agilent Technologies). The following instrumental settings were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... 70 kDa subunit (NF-L, 1:500, Agilent, Santa Clara, CA, #M0762). Immunostained sections were counterstained with hemalum.
-
bioRxiv - Physiology 2023Quote: ... both solvents containing 5 µmol/L Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Plant Biology 2024Quote: ... An external calibration with ESI-L Low Concentration Tuning Mix (Agilent Technologies) was performed prior to data collection ...
-
bioRxiv - Immunology 2024Quote: ... 1 mM L-Gln (200 mM stock; cat. no. 103579-100, Agilent), 0.5 mM L-carnitine (cat ...
-
bioRxiv - Microbiology 2021Quote: ... at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE, Agilent Technologie) at RT for 30min ...
-
bioRxiv - Biophysics 2021Quote: ... The MutL (R-E) mutation was generated using the QuikChange site-directed mutagenesis kit (Stratagene). Two serine residues separated the his6 and srt ...
-
bioRxiv - Immunology 2024Quote: ... Fc receptors were biotinylated and bound to Streptavidin-R-Phycoerythrin (Agilent, Santa Clara, CA, USA) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... The section was subsequently incubated in primary antibodies (GFAP,1:1000, D1F4Q, Cell Signaling or CD79A, 1:200, M705001-2 DAKO or CD3, 1:100, A0452 DAKO), in BTHP-buffer (1% bovine serum albumin (BSA) ...
-
bioRxiv - Microbiology 2021Quote: Organic acids and ethanol were measured by high-performance liquid chromatography (Agilent, 1260 Infinity), using a standard analytical system (Shimadzu ...
-
bioRxiv - Bioengineering 2020Quote: ... butyric acid and glucose were measured using a high-performance liquid chromatography (HPLC, Agilent Technologies 1260 Infinity series ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Residual sugars and organic acids were measured using a HPLC 1100 (Agilent Technologies, USA) equipped with an Aminex 75H column with 4 mM sulfuric acid as the mobile phase at 0.6 mL/min and analyzed using a refractive index detector (RID).
-
bioRxiv - Biophysics 2022Quote: ... Nucleic acid purification was performed using a high-performance liquid chromatography (HPLC, Agilent 1100) equipped with a diode array detector ...
-
bioRxiv - Microbiology 2020Quote: Steady-state fluorescence emission anisotropy (r) was measured with a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) equipped with a thermostated cuvette holder ...
-
bioRxiv - Neuroscience 2023Quote: ... XF L-Glutamine and cells were prepared for the Mito Stress Assay (Agilent) as per manufacture’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... B: Acetonitrile: Methanol − 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Physiology 2020Quote: The fatty acid oxidation (FAO) was measured using a microfluorimetric Seahorse XF96 Analyzer (Agilent Technologies) according to the protocol supplied by the manufacturer with minor modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... B: Acetonitrile: Methanol – 80:15 + 0.1% Acetic Acid) on an Eclipse Plus C18 Column (Agilent), and analysed on a Sciex QTRAP® 6500 LC-MS/MS system ...
-
bioRxiv - Cancer Biology 2024Quote: ... AMP-derivatised fatty acids as [M+H]+ were aligned using Mass Profinder v10.0 (Agilent Technologies) with an RT tolerance of 0.5 min and MS1 tolerance of 10 ppm ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... diethyl ether and purified on an Agilent 1200 series High-Performance Liquid Chromatography (HPLC) instrument (10–75% HPLC-grade acetonitrile for 20 minutes at a 2 mL/min flow rate over an Agilent Zorbax C18 column (5 µm, 9.4 x 250 mm) tracked at 220 ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Developmental Biology 2024Quote: ... R/A at the indicated time points (Seahorse XF Mito Stress Test Kit, 103015-100, Agilent, USA). Readings were then normalized to protein concentration/well measured using the Micro BCA™ Protein Assay Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Daily MS calibration was performed with ESI-L Low Concentration Tuning Mix (Agilent Technologies). The internal calibrant was Hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazene (Synquest Laboratories) ...
-
bioRxiv - Microbiology 2024Quote: ... The mass spectrometer was calibrated in negative mode using ESI-L solution from Agilent technologies every 6 h to maintain the best possible mass accuracy ...
-
bioRxiv - Microbiology 2023Quote: ... The mass spectrometer was calibrated in negative mode using ESI-L solution from Agilent technologies every 6 hours to maintain the best possible mass accuracy ...
-
bioRxiv - Bioengineering 2024Quote: ... L-006235 was quantified by liquid chromatography tandem mass spectrometry (LC-MS/MS; Agilent 6530 quadrupole time-of-flight mass spectrometer with 1290 infinity binary ultra-performance liquid chromatography system ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Cancer Biology 2024Quote: ... 30 mM ammonium acetate (NH4Ac) (aq) + 0.1% formic acid (FA) + 0.0015% InfinityLab Deactivator (Agilent Technologies, Inc.) in 1% MeOH ...
-
bioRxiv - Microbiology 2024Quote: ... Filtered samples (0.22 nitrocellulose filter) were analyzed for glucose and acetate acid using HPLC (Agilent 1260) with a refractive index detector and with a reverse-phase column C18 (Waters ...
-
bioRxiv - Cell Biology 2021Quote: ... An inducible V-1 expression plasmid was created by first PCR- amplifying the mtpn gene with V-1 F and V-1 R oligos (dictyBase:DDB_G0268038) using Ax2 genomic DNA then TA cloning the product using StrataClone (Agilent) to generateV-1 SC ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Cell Biology 2023Quote: ... These data analysis was performed in the R computing environment and GeneSpring GX software version 13.0 (Agilent Technologies).
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and a randomly selected subset of these embryos was assayed for the target locus disruption through genotyping PCR using vps13b_geno_F/R primers (see Supplementary materials Table S1) and resolving the resulting PCR products on Fragment Analyzer (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... The m/z scale was calibrated using the ESI-L low concentration tune mix (Agilent). As the dynamic-field IMS systems including TIMS cannot measure the absolute K values a priori ...
-
bioRxiv - Paleontology 2024Quote: ... and their extent of racemisation (D/L value) were then quantified using RP-HPLC (Agilent 1100 series HPLC fitted with HyperSil C18 base deactivated silica column (5 μm ...
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...