Labshake search
Citations for Agilent :
1551 - 1600 of 6160 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Adapter dilution (1:4) and PCR amplification (26 cycles) were optimized in a pilot experiment using Bioanalyzer DNA1000 (Agilent, Sant Clara, USA) chips as a read out of library size and quantity ...
-
bioRxiv - Biochemistry 2023Quote: ... All UTX isoforms and mutants were generated by PCR cloning into the pDONR221 vector or by site-directed mutagenesis using the QuikChange strategy (Agilent, CA, USA). Inserts were transferred to the pCDNA5_FRT_TO_N-GFP destination vector using GATEWAY cloning according to instructions of the manufacturer (Life technologies ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CrxE1/CAG::OC1 element was cloned using polymerase chain reaction (PCR) with the high fidelity Herculase II Fusion DNA Polymerase (Agilent cat# 600675) to add “Sal1” sites to the 261bp enhancer sequence ...
-
bioRxiv - Microbiology 2024Quote: ... 80 µL of the supernatant was removed before exposing the plate to a temperature gradient for 3 minutes in a PCR machine (Agilent SureCycler 8800), followed by 3 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... we used the primers SAR CCTGGACTACTGCGCCCTACAGA und R26F3 CTGCCCGAGCGGAAACGCCACTGAC.[16] The PCR was carried out using the Herculase II Fusion DNA Polymerase (Agilent Technologies, #600675) resulting in a ∼ 1.3 kb fragment ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were quantified by qPCR using the KAPA Library Quantification Kit for Illumina Libraries (KapaBiosystems; Cat#: KR0405) and library profiles were assessed using the DNA High Sensitivity HS Kit (Agilent; Cat#: 5067-4626) on an Agilent Bioanalyzer 2100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries fragment size distribution and concentration was assessed using Qubit dsDNA HS Assay Kit (Thermo Fischer Scientific, Q32851) and Agilent High Sensitivity DNA kit (Agilent Technologies, 5067-4626) on a bioanalyzer ...
-
bioRxiv - Cancer Biology 2024Quote: ... PolyA+ stranded RNA library was prepared using the Illumina Stranded mRNA Prep kit and quality was assessed by using the 2100 Bioanalyzer (Agilent, DNA 7500 kit). RNA-seq libraries have been pooled equimolarly and sequenced using NovaSeq6000 (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing libraries were prepared by targeted capture from 70 ng of genomic DNA using the SureSelect HT kit and the SureSelect Enzymatic Fragmentation Kit (Agilent, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... The electrical characteristics of the brain phantom were determined with a VNA equipped with a dielectric probe kit (85070E kit, Agilent Technologies, Santa Clara, CA) and were representative of the averaged human brain (er = 66.34 and σ = 0.49 S m−1) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA quality was assessed using an Agilent RNA Nano kit on a BioAnalyzer instrument (RNA 6000 Nano Kit, Agilent, Santa Clara, CA, United States). Libraries were subsequently prepared and sequenced at Psomagen ...
-
bioRxiv - Genomics 2024Quote: ... RNA quality was assessed using an Agilent 2100 Bioanalyzer with an RNA 6000 Nano Kit or RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA). ERCC ExFold RNA Spike-In Mixes (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... IMAGE:6292760)) cloned in the pOTB7 vector (IRAUp969D10104D, RZPD Imagenes, Germany) served as template for site-directed PCR-mutagenesis (QuickChange, Stratagene, La Jolla, CA) according to the manufacturer’s instructions and as described in [52] and using the primer pairs (10 nmol ...
-
bioRxiv - Neuroscience 2020Quote: ... Fragment size was determined by loading 1 ng/μl cleaned up PCR product on the Fragment Analyzer System (Agilent Technologies, Santa Clara, USA) using the qualitative DNA Kit dsDNA Reagent 35-5000bp (Cat No ...
-
bioRxiv - Microbiology 2020Quote: ... Full-length Vero-PVR1 and Vero-PVR2 cDNA was amplified with the Easy-A High Fidelity PCR Cloning Enzyme (Agilent Technologies, CA, USA), and cloned into T-vector pMD20 (Takara Bio Inc.) ...
-
bioRxiv - Cell Biology 2021Quote: Both PCRs were performed in 100 µl with the 2 µl of the Herculase II Fusion DNA Polymerase from Agilent (ref. no. 600675) according the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Fusion constructs and large deletions were generated by overhang extension PCR [79] using primers from IDT (IDT, Coralville, IA) and cloned Pfu DNA polymerase (Stratagene, La Jolla, CA). Point mutations and small deletions or insertions were generated using QuickChange [80] with Turbo Pfu DNA polymerase (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... The genomic SPL7 (AT5G18830.1) coding region (translational start to stop codon) was PCR-amplified and cloned into the pBluescript SK+ vector (Stratagene/Agilent Technologies, Waldbronn, Germany) which was used a PCR template for site-directed mutagenesis (A279T ...
-
bioRxiv - Pathology 2020Quote: ... beads were collected for 2 min on a magnet and then resuspended in 25 µL PCR master mix containing PCR1 primers and Herculase-II (Agilent, Santa Clara CA). PCR cycling was as follows ...
-
bioRxiv - Systems Biology 2023Quote: ... A total of 13 cycles was then used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System). Each type of library was pooled and sequenced using Illumina NovaSeq6000 System on SP flowcells [61] ...
-
bioRxiv - Genomics 2023Quote: ... The PCR products obtained were purified (AMPure XP system) and library quality was assessed on an Agilent Bioanalyzer 2100 system (Agilent Technologies, United States). Library preparations of RNA were sequenced on the Illumina NovaSeq 6000 platform (Illumina Inc ...
-
Activation of XBP1s attenuates disease severity in models of proteotoxic Charcot-Marie-Tooth type 1BbioRxiv - Neuroscience 2024Quote: ... and retrotranscribed as previously described.16 cDNAs were quantified by quantitative real-time PCR on a MX3000 apparatus (Stratagene, La Jolla, CA, USA) by using specific primers ...
-
bioRxiv - Microbiology 2023Quote: ... Sequence encoding the 96-120 NS2B residues was removed from recombinant pTrcHisA plasmid by PCR based site directed mutagenesis [40] using Pfu ultra II fusion HS DNA polymerase (Agilent, Santa Clara, USA) to generate recombinant plasmids expressing N-terminal hexahistidine tag fused active NS2B(H)-NS3(pro ...
-
bioRxiv - Microbiology 2024Quote: ... Quality assessment and quantification of the PCR products were respectively performed using the Agilent 2100 Bioanalyzer system (Agilent Technologies, Palo Alto, CA, USA) and a Qubit 2.0 Fluorometer (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... The locus-specific HDR donors were generated by PCR amplification of the MACHETE bicistronic cassette using a high-fidelity DNA polymerase (Herculase II, Agilent or Q5, NEB). PCR fragments were column purified (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... was performed in duplicate using TaqManTM Fast Advanced Master Mix (Cat # 44-445-57) for mRNA in a Mx3000p Real-Time PCR System (Stratagene, Santa Clara, CA). The primers for the qPCR were purchased from Thermo Fisher Scientific/TaqMan ...
-
bioRxiv - Molecular Biology 2024Quote: ... around 50 ng of parent plasmid was taken and mutations were introduced by inverse PCR reaction using Pfu Ultra II polymerase (Agilent, cat no. 600674) enzyme using primer pairs having the respective mutations ...
-
bioRxiv - Microbiology 2024Quote: ... Sample DNA were serially diluted 1:10 in sterile nuclease-free water to dilute the concentration of any PCR inhibitors using a liquid handler (Agilent, Agilent Velocity 11 Vprep). 16S rRNA concentrations from embryonic tissue are reported from undiluted DNA as its concentration was approaching the limit of detection in diluted reactions ...
-
bioRxiv - Plant Biology 2024Quote: ... Expression analysis was performed by quantitative real-time PCR (qRT-PCR) using a Stratagene® Mx3005P® qPCR System instrument and Brilliant III SYBR Green qPCR Master Mix with Low ROX (Agilent Technologies). The reaction was prepared with each primer (0.5 μL ...
-
bioRxiv - Cell Biology 2024Quote: XIST reactivated hPSCs were subjected to genotyping PCR using primer spanning gRNA targeting regions and checked by TapeStation (Agilent, Santa Clara, CA, USA) or electrophoresis ...
-
bioRxiv - Genomics 2021Quote: ... and examined with the 2100 Bioanalyzer (RNA6000 Pico Kit, Agilent, cat.no ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quick Change XL Site-Directed Mutagenesis Kit (200516, Agilent Technologies) was used to construct ZHX2 mutants ...
-
bioRxiv - Cancer Biology 2021Quote: ... and High Sensitivity DNA Kit (Agilent Technologies, Cat # 5067-4626). Generated DNA fragments were quantified with Qubit dsDNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... capillary electrophoresis instrument and the CRISPR Discovery Gel Kit (Agilent). To verify that the E-box was successfully replaced by the LexO site ...
-
bioRxiv - Cell Biology 2020Quote: ... Both vectors were edited using the QuickChange® kit (Stratagene) to generate constructs encoding PICK1 coding variants ...
-
bioRxiv - Genetics 2021Quote: Site-directed mutagenesis was performed with QuikChange II kit (Agilent), using manufacturer recommended procedures.
-
bioRxiv - Developmental Biology 2021Quote: ... Quality was confirmed using Agilent RNA 6000 Nano kit (Agilent) on the 2100 Bioanalyzer Instrument (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were prepared by SureSelectXT Library Prep Kit (Agilent), hybridized to the appropriate capture panel ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sheared by the Sure Select Enzymatic Fragmentation kit (Agilent Technologies Inc. ...
-
bioRxiv - Physiology 2022Quote: ... using an Agilent High Sensitivity DNA Kit (Agilent Technologies, France). Libraries were prepared from 0.15 ng cDNA using the Nextera XT Illumina library preparation kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... the QuickChange Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to introduce the above mutations into the constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Quikchange 2 Site-Directed Mutagenesis Kit (Agilent Technologies 210518) was used to introduce the two mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... XFe96 extracellular flux assay kit probes (Seahorse Bioscience 102601-100) were incubated with the included calibration solution overnight at 37°C under non-CO2-injected conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA content was measured with a Bioanalyzer pico kit (Agilent). 1% RNA SIRVs were spiked-in (Lexogen) ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... using an Agilent High Sensitivity DNA Kit (Agilent Technologies, France). Libraries were prepared from 0.15 ng cDNA using the Nextera XT Illumina library preparation kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit). Qualifying samples underwent library construction and sequencing at Novogene ...
-
bioRxiv - Genomics 2020Quote: ... We acquired plasmid pTXB1-Tn5 from Addgene and used the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) and the Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and quality checked with Bioanalyzer DNA High Sensitivity Kit (Agilent).
-
bioRxiv - Physiology 2020Quote: ... and Seahorse XF Mito Stress Test Kit (Agilent, 103015-100). 4 × 104 cells were plated into each well prior to the assay ...