Labshake search
Citations for Agilent :
1551 - 1600 of 3738 citations for Canine Adenovirus 1 and 2 Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 2 μg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 μm, 300Å, 1x75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 μl/min (solvent A ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Cancer Biology 2019Quote: ... using an anti-Ki67 monclonal antibody (MIB-1 clone at 1:100 dilution; DAKO Agilent Technologies LDA). The immunohistochemistry was scored manually at x400 magnification ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Immunology 2022Quote: ... except that rabbit-anti-mouse IgG-HRP (DAKO; 1:10.000 diluted in TBS-T with 1% BSA) was used as secondary antibody.
-
bioRxiv - Biochemistry 2024Quote: ... ab109401 (1:5000)) or and anti-total Tau antibody (rabbit anti-human Tau, Dako, #A0024 (1:5,000)) diluted in 3% BSA in PBS-T overnight at 4°C shaking ...
-
bioRxiv - Immunology 2023Quote: ... and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447; 1:5000 in 1% BSA and TBS-T)) and incubated for 1 h at room temperature with gentle shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:10 and 1:50 dilutions of the library on a Bioanalyzer High sensitivity DNA Chip (Agilent) and running it on Bioanalyzer 2100AB (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...
-
bioRxiv - Plant Biology 2021Quote: ... Grown colonies were screened with colony PCR using CP-F and UnivR primers and KAPA2G Robust HotStart Kit (Agilent, Supplemental Method 2). Sanger sequencing of the selected clone confirmed correct sequence of the PVY-coding part and correct in-frame insertion of GFP coding sequence ...
-
bioRxiv - Immunology 2021Quote: ... Paraffin sections (4µm thick) of FFPE thymus and lymph node tissues (NMR, mouse, and human control) were stained for cytokeratin (AE1/AE3, Dako GA05361-2) on a Dako Omnis autostainer with pressure cooker antigen retrieval (TrisEDTA ...
-
bioRxiv - Microbiology 2021Quote: ... were acidified with 5 µl of 30% HCl per 2 mL to prevent precipitation and measured by inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent Technologies 5100). Porewater for dissolved inorganic carbon (DIC ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2021Quote: ... Entry clones for other mutant dynamin 2 were prepared by introducing corresponding mutations into the Entry clone of wild type human dynamin 2 using QuikChange Lightning Site-directed Mutagenesis kit (Agilent Technologies, 210518) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... by polymerase chain reaction (PCR). Ki-67 (Catalog no. M7240) and CD4 (Catalog no. M731029-2) antibodies were purchased from Dako (CA, USA). FOXO3a (Catalog no ...
-
bioRxiv - Microbiology 2022Quote: ... Sialyl-Lewis a (sLea) and Sialyl-Lewis x (sLex/CD15s) were detected with 2 µg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX-1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... Sizes and yields of RACE products (2 µL aliquots) were determined using a Fragment Analyzer (Advanced Analytics; now Agilent, Santa Clara USA) equipped with 55 cm electrophoresis capillaries and reagents capable of resolving dsDNA fragments between 35 and 1500 bp (see Fig 1E) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the tissue was soaked in 200μl dichloromethane containing 200ng 2-tetradecyl acetate (internal standard) in 2ml glass vials with PTFE-coated caps (Agilent, Santa Clara, USA) for one hour ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were washed with TBST and slides were developed by adding AEC+ High Sensitivity Substrate Chromogen Ready to use (Dako K346111-2).
-
bioRxiv - Immunology 2021Quote: Point substitutions within RBD in SARS-CoV-2 spike gene were introduced by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol and by overlapping PCR strategy as described previously (Patil et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... three washes with phosphate buffered saline (PBS) and the incubation with the primary antibody in the DAKO Real TM antibody diluent (Agilent #S202230-2) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Genomics 2019Quote: ... Gene expression was performed on 7900 HT fast real time PCR system (Applied Biosystem, USA) using 2× Brilliant III SYBR@ Green qPCR Master Mix (Agilent Technologies, USA) and gene specific primers (Supplementary Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... After 10 minutes of formalin fixation of the tissue on the slides they were dried with isopropanol and stained with Mayer’s hematoxylin (Dako, cat.no.: S330930-2) and bluing buffer (Dako ...