Labshake search
Citations for Agilent :
1501 - 1550 of 6801 citations for Progesterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Microbiology 2023Quote: ... GC/MS analysis was performed on a Trace GC Ultra gas chromatograph with AS3000 Autosampler equipped with a Zorborbax DB-5 column (30 m, 0.25 mm i.d., 0.20 μm film thickness; Agilent J&W Scientific), with the eluate transferred at 280 °C to a Polaris Q mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of the protein extracts were run through a home-packed PLRP-S capillary column (200 mm long, 0.25 mm i.d., 5 μm particle size, 1000 Å pore size; Agilent Technology). The column was heated to 60 °C at an 8 μL/min flow rate ...
-
bioRxiv - Systems Biology 2023Quote: ... we used an Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 µm particle size, Agilent Technologies) and a Diode Array Detector (G4212 ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were centrifuged (20,000 x g for 10 min) and desalted using 5 uL C18 cartridges on the AssayMap BRAVO platform (Agilent Technologies). For each sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... then incubated with a goat anti-rabbit HRP-conjugated secondary antibody (Dako P0448, 1:2000 dilution in 5% BSA-PBST) for 2 hours at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... 10μL of purified protein was injected to a C-18 column (Agilent Zorbax 300SB-C18, 5 μM, 2.1 x 150mm) without dilution or buffer exchange ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: BAs in liver tissue and cecum content were extracted with methanol and 5 μL was injected onto a reverse-phased chromatography (1290 Infinity II, Agilent) and mass spectrometer (6546 Q-TOF/MS ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrate was injected into a C18 reversed-phase column (4.6 mm×150 mm, 5 μm particle size, Agilent, USA) in a Thermo-Fisher Ultimate 3000 separation module equipped with a DAD-3000 Diode Array Detector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Five μL of analyte was applied to an Eclipse XDB-C18 column (150 x 4.6 mm, 5 μm, Agilent Technologies) and separated using the following gradient at 1 mL/min ...
-
bioRxiv - Biochemistry 2023Quote: ... Online HPLC was performed on a U3000 RSLC nano Pro-flow system using a C3 column (Zorbax 300SB-C3, 5 µm; Agilent). Samples were maintained at 4 °C and 1 µL injected for each analysis using a microliter pickup ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then transferred immediately into a 5 mm NMR tube (Wilmad) and placed into a 600 MHz magnet with a coldprobe (Agilent). The peptide backbone was assigned using a combination of BEST versions of 3D HNCA ...
-
bioRxiv - Microbiology 2023Quote: ... The optical density was measured at 540 nm and subtracted from readings at 450 nm using the BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). Concentrations were calculated from standard curves run in parallel.
-
bioRxiv - Systems Biology 2023Quote: ... the peptides were reconstituted in 10 mM TEAB and fractionated using a bRPLC column (Agilent 300 Extend-C18 column, 5 µm, 4.6 mm × 250 mm, Agilent Technologies) under an increasing gradient of the mobile phases consisting of 10 mM TEAB in water and 90% acetonitrile (ACN) ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed in PBS and incubated in DAPI (1:500) for 5 min before mounting with the immunofluorescence mounting media (DAKO).
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Microbiology 2023Quote: ... Membrane fluidity was determined by using an excitation wavelength of 350 nm and measuring fluorescence at 460 nm and 500 nm emission wavelengths on a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The generalised polarisation (GP ...
-
bioRxiv - Molecular Biology 2023Quote: TEV eluates (about 650-700 µl) were partially digested for 5 min at 37 °C with 25 µl of RNase-IT (Agilent) diluted to 1:50 in TNM100 buffer and the reactions were stopped using 0.4 g guanidine hydrochloride ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Bioengineering 2023Quote: ... Peptides were loaded to a nanoscale HPLC column composed of 10 cm of Polaris C18 5 μm packing material (Agilent), followed by 4 cm of Partisphere 5 SCX (Whatman) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... cell nuclei were stained with DAPI for 5 min prior to mounting the cover slip onto a glass slide using DAKO mounting medium (Agilent). Cells were visualized through 63x ...
-
bioRxiv - Biochemistry 2024Quote: ... A Zorbax SB-C8 reversed-phase column (5 μm, 2.1 x 50 mm) was obtained from Agilent (Palo Alto, CA). The LC eluent was introduced into the ESI source of the mass spectrometer ...
-
bioRxiv - Neuroscience 2024Quote: ... sound stimuli consisted in single-cycle sound pips (5-ms duration at 200 Hz) produced by a function generator (33210A Agilent Technologies Inc. ...
-
bioRxiv - Biochemistry 2024Quote: ... The plates were then shaken for 2 minutes and luminescence was measured using the BioTek Cytation 5 cell imaging multimode reader (Agilent).
-
bioRxiv - Cell Biology 2024Quote: ... Mixtures were incubated at RT for 60 min in the dark and absorbance at OD570 was measured on a microplate reader (Bio Tek Cytation 5, Agilent). For each LD sample ...
-
bioRxiv - Immunology 2024Quote: ... Sections were blocked with 5% horse serum in 1% BSA solution and incubated with the anti-CD68 primary antibody (KP1, Dako) for 60 minutes at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... each library underwent a reconditioning PCR to reduce heteroduplexes: libraries were concentrated down to 5 µl and mixed with 10 µl of Herculase Buffer (Agilent), 5 µl of 2.5 nM dNTPs ...
-
bioRxiv - Cell Biology 2024Quote: ... The HPLC conditions employed two normal-phase Zorbax Sil (5 μm, 4.6 × 150 mm) columns (Agilent, Santa Clara, CA, USA), connected in series within the Multicolumn Thermostat compartment ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2,000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Microbiology 2019Quote: Quantitative PCR for the analysis of host genes expression was performed in 384-well plates in a final volume of 5µl using a Bravo Automated Liquid Handling Platform (Agilent Technologies, Palo Alto, CA, USA) and a ViiA 7 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2021Quote: ... The serial dilution was prepared by the robotic liquid handler in a 6 × 8 (48-well square) deep well plate (Agilent Part number 201306-100) according to the DilutionPlan (Section 3.1.3) ...
-
bioRxiv - Immunology 2022Quote: ... Reactions were stopped by adding 50 μL 3M hydrochloric acid and absorbance at 492 nm was determined on a Synergy 4 plate reader (BioTek, Agilent Technologies inc., CA, USA) or similar ...
-
bioRxiv - Immunology 2022Quote: Naive CD3+ T cells were placed on PLL-coated Seahorse Bioanalyzer XFp culture plates (3 × 105 cells/well) with Seahorse XF RPMI Assay Media (RPMI Medium, pH 7.4, 103576-100; Agilent Technologies, Santa Clara, CA, USA), supplemented with 10 mM glucose (103577-100 ...
-
bioRxiv - Microbiology 2022Quote: ... we triple parafilmed the 96 well plate lid and put it immediately into an optical reader (Biotek synergy HTX, Agilent, Santa Clara CA, USA) which incubated the plate at 30°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The well plate was then inserted into the humidified chamber at 37°C of an Agilent Lionheart FX Automated Microscope (Agilent Technologies, Santa Clara, CA). A band pass filter (Thorlabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Growth experiments were conducted (either at 100% air or 90% air / 10% CO2) in a BioTek Epoch 2 plate reader (Agilent, Santa Clara, CA, USA) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The cytoplasmic BlaM activity (ratio of blue to green fluorescence) was measured using a Synergy H1 plate reader (Agilent Technologies, Santa Clara, CA, USA).