Labshake search
Citations for Agilent :
1501 - 1550 of 1668 citations for 5 FLUORO 2 PHENYLBENZO D THIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: The EnVision™ staining kit (G|2 Double-stain System, Rabbit/Mouse, DAB+/Permanent RED code K5361; Agilent technologies, Dako DK) was used for the immunohistochemical stain of Mamu-DR ...
-
bioRxiv - Neuroscience 2021Quote: The optimal concentration was determined for each antibody: CD3 (polyclonal rabbit – anti-human CD3 IgG, cat. no. A045201-2, Agilent Technologies), 1:60 ...
-
bioRxiv - Developmental Biology 2021Quote: PSM cells were dissociated on day 2 of differentiation and reseeded onto fibronectin-coated Seahorse plates (Agilent cat. no. 101085-004) at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat ...
-
bioRxiv - Microbiology 2020Quote: ... Sialyl-Lewis a and Sialyl-Lewis x (sLex also known as CD15s) were detected with 2 μg/ml of mAbs NS-1116-19.9 (Dako, Agilent Technologies, USA) and CSLEX1 (Becton Dickinson ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... OCR and ECAR were measured at 37°C in Seahorse XF DMEM medium (pH7.4, with 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate) (Agilent, 103680-100). 1.5 μM Oligomycin ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Bioengineering 2023Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed in TBST and incubated for 1-2 h with the peroxidase-coupled secondary antibody (HRP-coupled anti-rabbit IgG (Dako, #P0448), HRP-coupled anti-mouse IgG (Dako ...
-
bioRxiv - Cell Biology 2019Quote: ... First peptides were fractionated using high pH reverse phase chromatography on a C18 column (150 × 2.1 mm i.d. - Kinetex EVO (5 μm, 100 Å)) on a HPLC system (Agilent, LC 1260 Infinity II, Agilent). A two-step gradient was applied ...
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody solution was then washed out 3x with TBS-T and TBS-T + 5% NFDM + 1:2000 Dako goat anti-rabbit or anti-mouse HRP-conjugated immunoglobulins (Agilent, Santa Clara, CA, USA) was added ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain sections were washed with PBS-Tween 0,05 % (PBS-T) and blocked with a peroxidase enzyme blocker for 5 minutes (Dako Dual Endogenous Enzyme Block S2003) and goat serum (NGS ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 samples of myoepithelial cells and 5 samples of s-SHIP GFP+ cap cells were submitted and subjected to quality analysis using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). All Samples had an average RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2021Quote: ... and endogenous peroxidase was blocked with 3% H2O2 in TBS for 5 min followed by incubation with anti-mouse EnVision+ labelled polymer (Agilent Technologies, Santa Clara, USA) for 30 min ...
-
bioRxiv - Biophysics 2019Quote: The MBP-5-HT3A-ICD-pMALX soluble fusion proteins were overexpressed in Escherichia coli (E. coli) BL21-CodonPlus (DE3)-RIPL cells (Agilent Technologies; Santa Clara, CA). The cells were harvested by centrifugation (5,000 g for 15 min at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... linear gradient from 5% to 35% ACN in 50 mM TEAAc pH 7 over 15 min at 50 °C, Agilent Technologies Series 1200 HPLC). The collected fractions were freeze dried 3 times ...
-
bioRxiv - Synthetic Biology 2020Quote: LC-MS analysis was performed with the ZORBAX SB-Aq StableBond Analytical column (5 μm, 4.6 × 250 mm, Agilent Teologies, Santa Clara, CA, USA) on an Agilent 1260/6460 Triple-Quadrupole LC/MS system (Santa Clara ...
-
bioRxiv - Immunology 2021Quote: ... TMT-labelled peptides were fractionated using high pH reverse phase chromatography on a C18 column (150 × 2.1 mm i.d. - Kinetex EVO (5 μm, 100 Å)) on a HPLC system (Agilent, LC 1260 Infinity II, Agilent). A two-step gradient was applied ...
-
bioRxiv - Physiology 2021Quote: ... was amplified by PCR using cDNA of mouse kidney at the template with the primers 5′-CCGTCGACATGCAGGTCAAGAAATCCTG-3′ (SalI site in italics) and 5′-CCGGATCCTTAAAGGCGTGTGTGATCTT-3′ (M6 reverse primer; BamHI site in italics) and cloned into pBluescript SK(−) (Stratagene, La Jolla, CA, USA) using the SalI and BamHI sites ...
-
bioRxiv - Physiology 2022Quote: ... The first was a DB 5 column (20 m long x 0.18 mm internal diameter x 0.18 μm thick) (Agilent J & W Scientific, Folsom, CA, USA), and the second a Rxi-17 column (0.84 m long x 0.1 mm internal diameter x 0.1 μm thick ...
-
bioRxiv - Cancer Biology 2023Quote: ... The analytes were separated on a Sciex C18 column (4.6 mm × 150 mm, 5 μm) maintained at 50°C using a 1260 Infinity HPLC instrument (Agilent Technologies, Santa Clara, CA, USA). A gradient flow of the mobile phase was applied ...
-
bioRxiv - Plant Biology 2023Quote: ... Aliquot of 5 μl of the eluate was injected into the LCMS system consisting of UHPLC 1290 Infinity II (Agilent, Santa Clara, CA, USA) coupled to 6495 Triple Quadrupole mass spectrometer (Agilent) ...
-
bioRxiv - Biochemistry 2022Quote: ... coupled with automated fraction collector in batches through a continuous gradient on an Agilent ZORBAX SB-C18 column (Agilent, 5 μm, 4.6 × 250 mm) at a column temperature of 40 °C to yield 45 fractions based on retention time and one fraction was collected per minute ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 min at room temperature prior to recording fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 488 nm and measuring emission at 535 nm ...
-
bioRxiv - Bioengineering 2024Quote: ... The diameter of cells adhered to TCP was measured by the Cytation 5 cell imaging multimode reader measurement tool (Agilent Technologies, Santa Clara, CA). In-suspension measurements were determined using the T4 Auto Cellometer Bright Field Cell Counter (Nexelom Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... the GC-MS analysis was performed with An OPTIMA 5 MS Accent fused-silica capillary column on Agilent7890A/5975C GC-MS system (Agilent Technologies Inc., CA, USA), while the LC-MS analysis was performed on a ThermoFisher Ultimate 3000 UHPLC system with a Waters ACQUITY UPLC BEH C18 column (2.1mm × 100 mm ...